Incidental Mutation 'R5814:Vmn2r45'
ID447679
Institutional Source Beutler Lab
Gene Symbol Vmn2r45
Ensembl Gene ENSMUSG00000090662
Gene Namevomeronasal 2, receptor 45
Synonyms
MMRRC Submission 043396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5814 (G1)
Quality Score221
Status Not validated
Chromosome7
Chromosomal Location8470525-8489075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8471476 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 851 (Y851F)
Ref Sequence ENSEMBL: ENSMUSP00000129466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164845]
Predicted Effect probably benign
Transcript: ENSMUST00000164845
AA Change: Y851F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000129466
Gene: ENSMUSG00000090662
AA Change: Y851F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 154 469 4.5e-26 PFAM
Pfam:NCD3G 512 565 6.4e-21 PFAM
Pfam:7tm_3 598 833 2.1e-54 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 91% (52/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,082 D135G probably benign Het
9130409I23Rik G A 1: 181,055,098 V142I probably damaging Het
Arrdc3 G T 13: 80,890,579 R220L possibly damaging Het
Bace1 A G 9: 45,860,264 D458G probably damaging Het
Cacna1s A G 1: 136,107,142 Y1360C probably benign Het
Ccnb1-ps T C 7: 42,107,098 noncoding transcript Het
Cd209b T C 8: 3,923,348 E112G probably damaging Het
Cit T A 5: 115,979,419 L1176Q probably damaging Het
Clcn3 T C 8: 60,934,573 Y214C probably damaging Het
Clvs2 G T 10: 33,528,507 Q238K probably benign Het
Creb3l3 C T 10: 81,085,662 V350M probably benign Het
Crot A C 5: 8,973,996 D373E probably damaging Het
Cyp4a12b T A 4: 115,432,497 I187N probably damaging Het
Dnhd1 C A 7: 105,719,895 A4291D possibly damaging Het
Dnmt3b A T 2: 153,672,497 E403D probably benign Het
Ect2l A T 10: 18,200,009 I43K probably damaging Het
Ep400 C A 5: 110,695,578 probably null Het
Erp27 A T 6: 136,911,566 V138E possibly damaging Het
Gbp4 G A 5: 105,119,919 A487V probably benign Het
Gm10142 C A 10: 77,716,123 T106N probably damaging Het
Gm11639 T A 11: 104,736,114 probably benign Het
Gxylt2 C A 6: 100,733,235 H112Q probably damaging Het
Hexim2 G A 11: 103,138,383 R87Q probably damaging Het
Hgf A G 5: 16,602,307 N399S probably benign Het
Ikbke T A 1: 131,271,779 I302F probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kdm1b A G 13: 47,063,146 probably null Het
Krtap19-9a T C 16: 88,924,114 noncoding transcript Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mmp10 G A 9: 7,503,620 A164T possibly damaging Het
Myrip G A 9: 120,424,668 G269D probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Paxbp1 G T 16: 91,030,496 R420S probably damaging Het
Pcbp2 T A 15: 102,483,162 S38R probably damaging Het
Pcf11 A G 7: 92,657,714 V1082A probably benign Het
Pkhd1 T C 1: 20,199,405 E3305G probably damaging Het
Pla2g4c T A 7: 13,340,618 W250R probably damaging Het
Prune2 A G 19: 17,016,361 probably null Het
Rpsa A G 9: 120,128,485 probably benign Het
Sema3e A G 5: 14,225,666 I262V probably benign Het
Setd2 T A 9: 110,567,758 L1663* probably null Het
Sh3d19 G A 3: 86,126,604 V755I probably benign Het
Smim4 A G 14: 31,124,520 probably null Het
Spag9 T A 11: 94,082,828 V14E possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sspo A T 6: 48,451,884 Q411L probably damaging Het
Sycp1 A C 3: 102,895,897 S532R probably benign Het
Taf6l C A 19: 8,774,846 A493S probably benign Het
Tsnaxip1 A G 8: 105,843,971 D574G probably benign Het
Ttll10 T A 4: 156,047,627 K117N possibly damaging Het
Utp4 T A 8: 106,912,275 I405K probably damaging Het
Vps33a T C 5: 123,565,056 D168G probably damaging Het
Other mutations in Vmn2r45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Vmn2r45 APN 7 8485623 missense probably benign 0.00
IGL01322:Vmn2r45 APN 7 8481333 missense possibly damaging 0.49
IGL01402:Vmn2r45 APN 7 8481468 missense probably damaging 0.98
IGL01404:Vmn2r45 APN 7 8481468 missense probably damaging 0.98
IGL01529:Vmn2r45 APN 7 8483494 missense probably benign
IGL01596:Vmn2r45 APN 7 8483273 missense probably damaging 0.98
IGL01646:Vmn2r45 APN 7 8483338 missense probably benign 0.18
IGL01819:Vmn2r45 APN 7 8485557 missense probably benign 0.00
IGL02096:Vmn2r45 APN 7 8481444 missense probably damaging 0.99
IGL02130:Vmn2r45 APN 7 8483557 missense possibly damaging 0.46
IGL02409:Vmn2r45 APN 7 8485728 missense probably benign 0.03
IGL02517:Vmn2r45 APN 7 8483186 nonsense probably null
IGL02633:Vmn2r45 APN 7 8485729 missense probably benign 0.01
IGL02940:Vmn2r45 APN 7 8472370 missense probably damaging 0.99
IGL03281:Vmn2r45 APN 7 8483604 missense probably damaging 1.00
IGL03358:Vmn2r45 APN 7 8471716 missense probably damaging 1.00
BB004:Vmn2r45 UTSW 7 8483514 missense probably benign
BB014:Vmn2r45 UTSW 7 8483514 missense probably benign
R0382:Vmn2r45 UTSW 7 8483099 missense probably benign 0.06
R0532:Vmn2r45 UTSW 7 8471821 missense probably damaging 0.99
R0932:Vmn2r45 UTSW 7 8475381 missense probably damaging 1.00
R1125:Vmn2r45 UTSW 7 8485543 missense probably benign 0.00
R1580:Vmn2r45 UTSW 7 8471747 missense possibly damaging 0.95
R1817:Vmn2r45 UTSW 7 8472373 missense probably damaging 1.00
R1996:Vmn2r45 UTSW 7 8472025 missense probably damaging 1.00
R2050:Vmn2r45 UTSW 7 8472022 missense probably damaging 1.00
R2284:Vmn2r45 UTSW 7 8485766 missense probably benign 0.02
R4019:Vmn2r45 UTSW 7 8471581 nonsense probably null
R4227:Vmn2r45 UTSW 7 8483278 missense probably damaging 0.98
R4381:Vmn2r45 UTSW 7 8471913 nonsense probably null
R4618:Vmn2r45 UTSW 7 8483437 missense probably benign 0.00
R4624:Vmn2r45 UTSW 7 8481342 missense probably damaging 1.00
R4704:Vmn2r45 UTSW 7 8483536 nonsense probably null
R4735:Vmn2r45 UTSW 7 8483473 missense probably damaging 1.00
R4868:Vmn2r45 UTSW 7 8481481 missense probably benign 0.06
R4983:Vmn2r45 UTSW 7 8483117 missense probably damaging 0.99
R5246:Vmn2r45 UTSW 7 8483252 missense probably benign 0.00
R5430:Vmn2r45 UTSW 7 8483334 nonsense probably null
R5504:Vmn2r45 UTSW 7 8483177 missense probably benign 0.03
R5511:Vmn2r45 UTSW 7 8471833 missense probably benign 0.19
R5745:Vmn2r45 UTSW 7 8483075 missense probably benign 0.00
R6223:Vmn2r45 UTSW 7 8483302 missense probably benign
R6267:Vmn2r45 UTSW 7 8472208 missense probably benign 0.26
R6623:Vmn2r45 UTSW 7 8471501 missense probably benign 0.09
R6999:Vmn2r45 UTSW 7 8483220 missense probably benign
R7242:Vmn2r45 UTSW 7 8485613 nonsense probably null
R7491:Vmn2r45 UTSW 7 8481343 missense probably benign 0.27
R7620:Vmn2r45 UTSW 7 8483223 nonsense probably null
R7719:Vmn2r45 UTSW 7 8483461 missense probably damaging 0.99
R7720:Vmn2r45 UTSW 7 8483461 missense probably damaging 0.99
R7853:Vmn2r45 UTSW 7 8482988 missense possibly damaging 0.90
R7873:Vmn2r45 UTSW 7 8483075 missense probably benign 0.00
R7882:Vmn2r45 UTSW 7 8483410 missense possibly damaging 0.82
R7927:Vmn2r45 UTSW 7 8483514 missense probably benign
U24488:Vmn2r45 UTSW 7 8472362 missense probably damaging 1.00
Z1088:Vmn2r45 UTSW 7 8471485 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCAAGATTTTATGGACACTGTAGGG -3'
(R):5'- TTCCTGACGCATTCAATGAAGC -3'

Sequencing Primer
(F):5'- TTATGGACACTGTAGGGAAGTTCAG -3'
(R):5'- GAAGCCAAGTTCTTGACCTTCAG -3'
Posted On2016-12-15