Incidental Mutation 'R0545:Ttc21a'
ID 44768
Institutional Source Beutler Lab
Gene Symbol Ttc21a
Ensembl Gene ENSMUSG00000032514
Gene Name tetratricopeptide repeat domain 21A
Synonyms Thm2, 4921538N17Rik
MMRRC Submission 038737-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R0545 (G1)
Quality Score 209
Status Validated
Chromosome 9
Chromosomal Location 119766672-119796859 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119787865 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 811 (L811Q)
Ref Sequence ENSEMBL: ENSMUSP00000035100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035100] [ENSMUST00000177637]
AlphaFold Q8C0S4
Predicted Effect probably damaging
Transcript: ENSMUST00000035100
AA Change: L811Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035100
Gene: ENSMUSG00000032514
AA Change: L811Q

DomainStartEndE-ValueType
low complexity region 107 118 N/A INTRINSIC
Blast:TPR 214 247 6e-11 BLAST
TPR 326 359 4.55e1 SMART
TPR 494 527 1.97e1 SMART
Blast:TPR 528 561 1e-14 BLAST
TPR 565 598 2.63e1 SMART
Blast:TPR 617 649 6e-11 BLAST
TPR 721 754 1.33e0 SMART
TPR 755 788 4.84e-3 SMART
TPR 790 821 1.14e1 SMART
TPR 883 916 9.03e-3 SMART
low complexity region 921 935 N/A INTRINSIC
TPR 951 984 1.08e1 SMART
Blast:TPR 1022 1054 3e-12 BLAST
low complexity region 1117 1129 N/A INTRINSIC
TPR 1195 1228 2.22e-2 SMART
TPR 1264 1297 9.73e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161967
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,547,187 (GRCm39) R76H probably damaging Het
Adnp2 T C 18: 80,172,616 (GRCm39) I598V probably benign Het
Ago3 T C 4: 126,311,025 (GRCm39) N63D probably damaging Het
Alkbh7 C T 17: 57,306,012 (GRCm39) R138* probably null Het
Atp6ap1l T C 13: 91,031,782 (GRCm39) H300R probably benign Het
BC051076 C T 5: 88,111,349 (GRCm39) noncoding transcript Het
Bltp1 G A 3: 37,041,839 (GRCm39) probably benign Het
Bpifb9a T A 2: 154,103,870 (GRCm39) C104* probably null Het
Cacna2d2 T C 9: 107,402,422 (GRCm39) L826P probably damaging Het
Car5b G A X: 162,762,297 (GRCm39) R282C probably damaging Het
Ccdc88c T C 12: 100,913,447 (GRCm39) D526G probably damaging Het
Cdh23 T A 10: 60,167,070 (GRCm39) T1861S probably benign Het
Ces2f A C 8: 105,676,668 (GRCm39) M121L possibly damaging Het
Cfap58 G A 19: 47,929,536 (GRCm39) probably benign Het
Chpf2 T C 5: 24,795,322 (GRCm39) S282P possibly damaging Het
Cluap1 C T 16: 3,751,636 (GRCm39) R332W probably damaging Het
Cma2 A T 14: 56,210,570 (GRCm39) M86L probably benign Het
Cog6 A T 3: 52,903,496 (GRCm39) M134K probably damaging Het
Col1a1 A G 11: 94,842,420 (GRCm39) D1446G unknown Het
Cpne8 T A 15: 90,381,278 (GRCm39) D512V probably damaging Het
Ctnna2 T A 6: 77,582,165 (GRCm39) N352I probably damaging Het
Cyp2c69 A C 19: 39,875,105 (GRCm39) L16R probably damaging Het
Dysf T C 6: 84,076,443 (GRCm39) S603P probably damaging Het
Epha5 A G 5: 84,215,217 (GRCm39) probably null Het
Ercc3 T C 18: 32,378,955 (GRCm39) S270P probably damaging Het
F10 T A 8: 13,098,249 (GRCm39) C151S probably damaging Het
Gpr180 T G 14: 118,397,458 (GRCm39) H317Q possibly damaging Het
Gstp2 T C 19: 4,091,633 (GRCm39) E32G possibly damaging Het
Ikzf5 T C 7: 130,994,229 (GRCm39) T133A possibly damaging Het
Itch G T 2: 155,024,218 (GRCm39) G274* probably null Het
Jarid2 T A 13: 45,056,307 (GRCm39) N365K probably benign Het
Lama3 T A 18: 12,694,758 (GRCm39) S1295T possibly damaging Het
Lipc A G 9: 70,719,987 (GRCm39) L255P probably damaging Het
Lrrc38 A G 4: 143,077,328 (GRCm39) D197G probably benign Het
Mfap2 A G 4: 140,741,496 (GRCm39) probably benign Het
Mfhas1 A G 8: 36,056,202 (GRCm39) K226E probably damaging Het
Morc1 A G 16: 48,386,020 (GRCm39) R548G probably benign Het
Mrgprb5 T C 7: 47,818,633 (GRCm39) N34S probably benign Het
Mroh4 T C 15: 74,497,276 (GRCm39) T182A probably benign Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Myo5a T C 9: 75,074,319 (GRCm39) F743L possibly damaging Het
Notch4 A C 17: 34,802,407 (GRCm39) D1276A probably damaging Het
Or1e34 A T 11: 73,778,843 (GRCm39) Y118* probably null Het
Or3a10 A G 11: 73,935,873 (GRCm39) C76R possibly damaging Het
Or6c209 T A 10: 129,483,218 (GRCm39) C74S probably damaging Het
Or6d15 T A 6: 116,559,617 (GRCm39) I97L probably benign Het
Plin4 T A 17: 56,413,567 (GRCm39) T353S probably damaging Het
Ppp1r9a A G 6: 5,115,357 (GRCm39) T827A probably benign Het
Prlr C T 15: 10,317,652 (GRCm39) T40I probably damaging Het
Psme3 T C 11: 101,210,730 (GRCm39) probably benign Het
Pygb A T 2: 150,657,626 (GRCm39) D363V probably benign Het
Rsph6a C T 7: 18,788,871 (GRCm39) Q68* probably null Het
Serpini2 A G 3: 75,165,445 (GRCm39) V178A probably benign Het
Sh2d2a T C 3: 87,759,195 (GRCm39) probably benign Het
Skint7 A C 4: 111,837,395 (GRCm39) M58L probably benign Het
Slco3a1 G T 7: 73,970,301 (GRCm39) Y435* probably null Het
Stk17b T C 1: 53,801,742 (GRCm39) probably benign Het
Tinag T A 9: 76,938,992 (GRCm39) H162L possibly damaging Het
Ttc41 A T 10: 86,594,961 (GRCm39) M912L probably benign Het
Vmn2r98 G T 17: 19,273,875 (GRCm39) V41F probably benign Het
Washc5 C T 15: 59,213,942 (GRCm39) C838Y possibly damaging Het
Wrnip1 A G 13: 32,990,796 (GRCm39) T352A probably damaging Het
Zan A C 5: 137,394,439 (GRCm39) C4467G unknown Het
Zc3h7a T C 16: 10,970,197 (GRCm39) probably benign Het
Zfp729a C A 13: 67,768,345 (GRCm39) C628F probably benign Het
Other mutations in Ttc21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Ttc21a APN 9 119,794,885 (GRCm39) missense probably damaging 0.96
IGL01996:Ttc21a APN 9 119,787,182 (GRCm39) missense probably damaging 0.99
IGL02160:Ttc21a APN 9 119,785,989 (GRCm39) missense probably damaging 1.00
IGL02163:Ttc21a APN 9 119,779,901 (GRCm39) nonsense probably null
IGL02252:Ttc21a APN 9 119,785,994 (GRCm39) missense probably damaging 1.00
IGL02901:Ttc21a APN 9 119,787,347 (GRCm39) missense probably damaging 0.98
IGL03105:Ttc21a APN 9 119,771,642 (GRCm39) missense probably benign 0.01
IGL03155:Ttc21a APN 9 119,773,042 (GRCm39) critical splice donor site probably null
IGL03323:Ttc21a APN 9 119,769,602 (GRCm39) intron probably benign
R0054:Ttc21a UTSW 9 119,773,006 (GRCm39) missense probably damaging 1.00
R0398:Ttc21a UTSW 9 119,783,628 (GRCm39) missense probably damaging 1.00
R0452:Ttc21a UTSW 9 119,768,220 (GRCm39) intron probably benign
R0541:Ttc21a UTSW 9 119,785,892 (GRCm39) intron probably benign
R0605:Ttc21a UTSW 9 119,790,908 (GRCm39) missense possibly damaging 0.93
R1352:Ttc21a UTSW 9 119,783,718 (GRCm39) missense possibly damaging 0.49
R1417:Ttc21a UTSW 9 119,783,327 (GRCm39) missense probably damaging 0.99
R1471:Ttc21a UTSW 9 119,771,707 (GRCm39) missense probably damaging 1.00
R1479:Ttc21a UTSW 9 119,786,013 (GRCm39) missense probably benign 0.00
R1631:Ttc21a UTSW 9 119,783,228 (GRCm39) splice site probably null
R1905:Ttc21a UTSW 9 119,795,823 (GRCm39) missense possibly damaging 0.82
R2141:Ttc21a UTSW 9 119,793,361 (GRCm39) missense probably damaging 0.98
R2213:Ttc21a UTSW 9 119,769,527 (GRCm39) missense probably benign 0.01
R2265:Ttc21a UTSW 9 119,788,074 (GRCm39) missense possibly damaging 0.62
R2327:Ttc21a UTSW 9 119,795,189 (GRCm39) missense probably damaging 1.00
R2656:Ttc21a UTSW 9 119,770,331 (GRCm39) missense probably damaging 0.98
R3000:Ttc21a UTSW 9 119,781,320 (GRCm39) missense probably benign 0.02
R3792:Ttc21a UTSW 9 119,783,231 (GRCm39) missense probably damaging 1.00
R3938:Ttc21a UTSW 9 119,779,882 (GRCm39) intron probably benign
R4232:Ttc21a UTSW 9 119,771,684 (GRCm39) missense probably benign 0.00
R4492:Ttc21a UTSW 9 119,770,346 (GRCm39) missense probably benign 0.00
R4498:Ttc21a UTSW 9 119,787,885 (GRCm39) missense possibly damaging 0.82
R4655:Ttc21a UTSW 9 119,790,828 (GRCm39) missense possibly damaging 0.80
R4890:Ttc21a UTSW 9 119,788,103 (GRCm39) missense probably benign
R4960:Ttc21a UTSW 9 119,774,067 (GRCm39) missense possibly damaging 0.51
R4972:Ttc21a UTSW 9 119,774,027 (GRCm39) missense probably benign 0.00
R5015:Ttc21a UTSW 9 119,795,195 (GRCm39) missense probably damaging 0.98
R5092:Ttc21a UTSW 9 119,771,731 (GRCm39) missense probably benign 0.01
R5117:Ttc21a UTSW 9 119,795,631 (GRCm39) missense possibly damaging 0.64
R5123:Ttc21a UTSW 9 119,781,278 (GRCm39) missense probably benign 0.04
R5452:Ttc21a UTSW 9 119,780,037 (GRCm39) missense probably benign 0.00
R5733:Ttc21a UTSW 9 119,770,327 (GRCm39) missense probably benign
R5734:Ttc21a UTSW 9 119,795,732 (GRCm39) missense probably benign
R5869:Ttc21a UTSW 9 119,787,858 (GRCm39) missense probably benign 0.03
R6214:Ttc21a UTSW 9 119,795,838 (GRCm39) missense probably damaging 1.00
R6215:Ttc21a UTSW 9 119,795,838 (GRCm39) missense probably damaging 1.00
R6279:Ttc21a UTSW 9 119,790,905 (GRCm39) missense possibly damaging 0.78
R6284:Ttc21a UTSW 9 119,773,028 (GRCm39) missense probably damaging 1.00
R6300:Ttc21a UTSW 9 119,790,905 (GRCm39) missense possibly damaging 0.78
R6800:Ttc21a UTSW 9 119,770,268 (GRCm39) missense possibly damaging 0.61
R6833:Ttc21a UTSW 9 119,771,701 (GRCm39) missense probably benign 0.24
R7009:Ttc21a UTSW 9 119,787,139 (GRCm39) nonsense probably null
R7060:Ttc21a UTSW 9 119,795,742 (GRCm39) missense probably damaging 0.98
R7170:Ttc21a UTSW 9 119,774,607 (GRCm39) missense probably damaging 0.99
R7418:Ttc21a UTSW 9 119,788,117 (GRCm39) missense probably benign 0.01
R7438:Ttc21a UTSW 9 119,774,605 (GRCm39) missense probably damaging 1.00
R7595:Ttc21a UTSW 9 119,787,135 (GRCm39) missense probably benign 0.12
R7703:Ttc21a UTSW 9 119,788,095 (GRCm39) missense probably benign 0.14
R8076:Ttc21a UTSW 9 119,795,392 (GRCm39) missense probably benign 0.01
R8217:Ttc21a UTSW 9 119,783,694 (GRCm39) missense probably benign 0.00
R8471:Ttc21a UTSW 9 119,792,242 (GRCm39) splice site probably null
R8558:Ttc21a UTSW 9 119,787,835 (GRCm39) missense probably damaging 0.97
R8696:Ttc21a UTSW 9 119,772,977 (GRCm39) missense possibly damaging 0.80
R8739:Ttc21a UTSW 9 119,796,371 (GRCm39) missense probably benign 0.00
R8768:Ttc21a UTSW 9 119,770,286 (GRCm39) missense probably damaging 1.00
R8912:Ttc21a UTSW 9 119,770,367 (GRCm39) critical splice donor site probably null
R9006:Ttc21a UTSW 9 119,792,130 (GRCm39) intron probably benign
R9214:Ttc21a UTSW 9 119,772,941 (GRCm39) missense probably benign 0.17
R9235:Ttc21a UTSW 9 119,774,559 (GRCm39) missense probably benign 0.03
R9521:Ttc21a UTSW 9 119,787,181 (GRCm39) missense probably damaging 0.98
R9643:Ttc21a UTSW 9 119,771,686 (GRCm39) missense probably benign
RF004:Ttc21a UTSW 9 119,795,838 (GRCm39) missense probably damaging 1.00
Z1177:Ttc21a UTSW 9 119,771,746 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGAAGCCAAACTGATGCCC -3'
(R):5'- GTGGCTCTTGTAAACCTTTGCCAAC -3'

Sequencing Primer
(F):5'- AAACTGATGCCCATATGTCCTG -3'
(R):5'- GATGTCCTTGACCCCTAGAAG -3'
Posted On 2013-06-11