Incidental Mutation 'R5814:Pcf11'
ID447682
Institutional Source Beutler Lab
Gene Symbol Pcf11
Ensembl Gene ENSMUSG00000041328
Gene NamePCF11 cleavage and polyadenylation factor subunit
Synonyms2500001H09Rik, 5730417B17Rik
MMRRC Submission 043396-MU
Accession Numbers

Genbank: NM_029078; MGI: 1919579

Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R5814 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location92643543-92669934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92657714 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1082 (V1082A)
Ref Sequence ENSEMBL: ENSMUSP00000113717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119954]
Predicted Effect probably benign
Transcript: ENSMUST00000119954
AA Change: V1082A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113717
Gene: ENSMUSG00000041328
AA Change: V1082A

DomainStartEndE-ValueType
RPR 17 139 6.74e-43 SMART
low complexity region 173 194 N/A INTRINSIC
coiled coil region 202 243 N/A INTRINSIC
low complexity region 355 380 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
low complexity region 471 513 N/A INTRINSIC
low complexity region 793 819 N/A INTRINSIC
low complexity region 833 853 N/A INTRINSIC
internal_repeat_1 854 931 1.77e-14 PROSPERO
low complexity region 932 948 N/A INTRINSIC
internal_repeat_1 969 1105 1.77e-14 PROSPERO
low complexity region 1159 1178 N/A INTRINSIC
low complexity region 1294 1315 N/A INTRINSIC
low complexity region 1445 1458 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000151177
AA Change: V1004A
SMART Domains Protein: ENSMUSP00000115278
Gene: ENSMUSG00000041328
AA Change: V1004A

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
low complexity region 147 172 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 263 305 N/A INTRINSIC
low complexity region 716 742 N/A INTRINSIC
low complexity region 756 776 N/A INTRINSIC
internal_repeat_1 777 854 3.34e-13 PROSPERO
low complexity region 855 871 N/A INTRINSIC
internal_repeat_1 892 1028 3.34e-13 PROSPERO
low complexity region 1082 1101 N/A INTRINSIC
low complexity region 1217 1238 N/A INTRINSIC
low complexity region 1368 1381 N/A INTRINSIC
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 91% (52/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to CLP1 to form pre-mRNA cleavage factor IIm. The encoded protein is necessary for efficient Pol II transcription termination and may be involved in degradation of the 3' product of polyA site cleavage. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,082 D135G probably benign Het
9130409I23Rik G A 1: 181,055,098 V142I probably damaging Het
Arrdc3 G T 13: 80,890,579 R220L possibly damaging Het
Bace1 A G 9: 45,860,264 D458G probably damaging Het
Cacna1s A G 1: 136,107,142 Y1360C probably benign Het
Ccnb1-ps T C 7: 42,107,098 noncoding transcript Het
Cd209b T C 8: 3,923,348 E112G probably damaging Het
Cit T A 5: 115,979,419 L1176Q probably damaging Het
Clcn3 T C 8: 60,934,573 Y214C probably damaging Het
Clvs2 G T 10: 33,528,507 Q238K probably benign Het
Creb3l3 C T 10: 81,085,662 V350M probably benign Het
Crot A C 5: 8,973,996 D373E probably damaging Het
Cyp4a12b T A 4: 115,432,497 I187N probably damaging Het
Dnhd1 C A 7: 105,719,895 A4291D possibly damaging Het
Dnmt3b A T 2: 153,672,497 E403D probably benign Het
Ect2l A T 10: 18,200,009 I43K probably damaging Het
Ep400 C A 5: 110,695,578 probably null Het
Erp27 A T 6: 136,911,566 V138E possibly damaging Het
Gbp4 G A 5: 105,119,919 A487V probably benign Het
Gm10142 C A 10: 77,716,123 T106N probably damaging Het
Gm11639 T A 11: 104,736,114 probably benign Het
Gxylt2 C A 6: 100,733,235 H112Q probably damaging Het
Hexim2 G A 11: 103,138,383 R87Q probably damaging Het
Hgf A G 5: 16,602,307 N399S probably benign Het
Ikbke T A 1: 131,271,779 I302F probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kdm1b A G 13: 47,063,146 probably null Het
Krtap19-9a T C 16: 88,924,114 noncoding transcript Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mmp10 G A 9: 7,503,620 A164T possibly damaging Het
Myrip G A 9: 120,424,668 G269D probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Paxbp1 G T 16: 91,030,496 R420S probably damaging Het
Pcbp2 T A 15: 102,483,162 S38R probably damaging Het
Pkhd1 T C 1: 20,199,405 E3305G probably damaging Het
Pla2g4c T A 7: 13,340,618 W250R probably damaging Het
Prune2 A G 19: 17,016,361 probably null Het
Rpsa A G 9: 120,128,485 probably benign Het
Sema3e A G 5: 14,225,666 I262V probably benign Het
Setd2 T A 9: 110,567,758 L1663* probably null Het
Sh3d19 G A 3: 86,126,604 V755I probably benign Het
Smim4 A G 14: 31,124,520 probably null Het
Spag9 T A 11: 94,082,828 V14E possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sspo A T 6: 48,451,884 Q411L probably damaging Het
Sycp1 A C 3: 102,895,897 S532R probably benign Het
Taf6l C A 19: 8,774,846 A493S probably benign Het
Tsnaxip1 A G 8: 105,843,971 D574G probably benign Het
Ttll10 T A 4: 156,047,627 K117N possibly damaging Het
Utp4 T A 8: 106,912,275 I405K probably damaging Het
Vmn2r45 T A 7: 8,471,476 Y851F probably benign Het
Vps33a T C 5: 123,565,056 D168G probably damaging Het
Other mutations in Pcf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Pcf11 APN 7 92661686 missense possibly damaging 0.51
IGL02439:Pcf11 APN 7 92661841 missense possibly damaging 0.93
IGL02658:Pcf11 APN 7 92647046 missense probably damaging 1.00
IGL02702:Pcf11 APN 7 92661618 missense possibly damaging 0.76
3-1:Pcf11 UTSW 7 92658518 missense probably damaging 1.00
R0015:Pcf11 UTSW 7 92658317 missense probably benign 0.28
R0015:Pcf11 UTSW 7 92658317 missense probably benign 0.28
R0078:Pcf11 UTSW 7 92669559 missense possibly damaging 0.90
R0110:Pcf11 UTSW 7 92657831 missense probably damaging 1.00
R0373:Pcf11 UTSW 7 92661215 missense probably benign
R0450:Pcf11 UTSW 7 92657831 missense probably damaging 1.00
R1717:Pcf11 UTSW 7 92663585 missense probably benign 0.00
R1952:Pcf11 UTSW 7 92661338 missense probably damaging 1.00
R1965:Pcf11 UTSW 7 92661601 missense probably benign
R2045:Pcf11 UTSW 7 92661879 missense probably damaging 1.00
R2245:Pcf11 UTSW 7 92665872 unclassified probably benign
R3824:Pcf11 UTSW 7 92659620 intron probably benign
R4439:Pcf11 UTSW 7 92658017 missense probably damaging 0.99
R4517:Pcf11 UTSW 7 92646488 missense probably damaging 1.00
R4671:Pcf11 UTSW 7 92657529 missense possibly damaging 0.62
R4674:Pcf11 UTSW 7 92659777 intron probably benign
R4675:Pcf11 UTSW 7 92659777 intron probably benign
R4732:Pcf11 UTSW 7 92658833 missense probably benign 0.33
R4733:Pcf11 UTSW 7 92658833 missense probably benign 0.33
R4758:Pcf11 UTSW 7 92661175 missense probably damaging 0.97
R4985:Pcf11 UTSW 7 92661902 missense probably benign 0.01
R5041:Pcf11 UTSW 7 92658405 missense probably benign 0.00
R5248:Pcf11 UTSW 7 92661491 missense probably damaging 1.00
R5688:Pcf11 UTSW 7 92658808 missense possibly damaging 0.92
R6240:Pcf11 UTSW 7 92646502 missense probably damaging 1.00
R6327:Pcf11 UTSW 7 92659609 intron probably benign
R6615:Pcf11 UTSW 7 92657882 missense probably damaging 0.96
R6795:Pcf11 UTSW 7 92657578 missense probably benign 0.04
R6896:Pcf11 UTSW 7 92649551 missense probably damaging 0.99
R6902:Pcf11 UTSW 7 92658299 missense probably damaging 0.99
R7030:Pcf11 UTSW 7 92657678 missense probably benign 0.21
R7135:Pcf11 UTSW 7 92657316 missense probably benign 0.05
R7162:Pcf11 UTSW 7 92664013 missense probably damaging 0.97
R7210:Pcf11 UTSW 7 92663476 missense probably benign
R7243:Pcf11 UTSW 7 92660060 missense probably damaging 1.00
R7362:Pcf11 UTSW 7 92653245 missense possibly damaging 0.83
R7876:Pcf11 UTSW 7 92661326 missense probably damaging 1.00
R8208:Pcf11 UTSW 7 92649523 missense probably damaging 1.00
R8212:Pcf11 UTSW 7 92659498 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTCTTTGGAACTGTAATCCTTGAG -3'
(R):5'- CTGAGAATTGAAGGGCCTCTG -3'

Sequencing Primer
(F):5'- TGGAACTGTAATCCTTGAGATGGAAC -3'
(R):5'- ATTGAAGGGCCTCTGGGTCAAG -3'
Posted On2016-12-15