Incidental Mutation 'R5814:Utp4'
ID447688
Institutional Source Beutler Lab
Gene Symbol Utp4
Ensembl Gene ENSMUSG00000041438
Gene NameUTP4 small subunit processome component
SynonymsTex292, TEG-292, Cirh1a
MMRRC Submission 043396-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5814 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location106893636-106923088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106912275 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 405 (I405K)
Ref Sequence ENSEMBL: ENSMUSP00000048377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047629]
Predicted Effect probably damaging
Transcript: ENSMUST00000047629
AA Change: I405K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048377
Gene: ENSMUSG00000041438
AA Change: I405K

DomainStartEndE-ValueType
WD40 5 44 6.19e-1 SMART
WD40 48 87 1.48e1 SMART
WD40 90 129 5.39e-5 SMART
WD40 134 172 1.48e-2 SMART
WD40 185 222 7.96e0 SMART
WD40 225 264 3.55e1 SMART
WD40 276 313 7.96e0 SMART
Blast:WD40 378 417 2e-19 BLAST
WD40 426 465 8.25e0 SMART
WD40 470 512 3.99e-1 SMART
WD40 515 554 2.22e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212718
Meta Mutation Damage Score 0.8554 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 91% (52/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD40-repeat-containing protein that is localized to the nucleolus. Mutation of this gene causes North American Indian childhood cirrhosis, a severe intrahepatic cholestasis that results in transient neonatal jaundice, and progresses to periportal fibrosis and cirrhosis in childhood and adolescence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,082 D135G probably benign Het
9130409I23Rik G A 1: 181,055,098 V142I probably damaging Het
Arrdc3 G T 13: 80,890,579 R220L possibly damaging Het
Bace1 A G 9: 45,860,264 D458G probably damaging Het
Cacna1s A G 1: 136,107,142 Y1360C probably benign Het
Ccnb1-ps T C 7: 42,107,098 noncoding transcript Het
Cd209b T C 8: 3,923,348 E112G probably damaging Het
Cit T A 5: 115,979,419 L1176Q probably damaging Het
Clcn3 T C 8: 60,934,573 Y214C probably damaging Het
Clvs2 G T 10: 33,528,507 Q238K probably benign Het
Creb3l3 C T 10: 81,085,662 V350M probably benign Het
Crot A C 5: 8,973,996 D373E probably damaging Het
Cyp4a12b T A 4: 115,432,497 I187N probably damaging Het
Dnhd1 C A 7: 105,719,895 A4291D possibly damaging Het
Dnmt3b A T 2: 153,672,497 E403D probably benign Het
Ect2l A T 10: 18,200,009 I43K probably damaging Het
Ep400 C A 5: 110,695,578 probably null Het
Erp27 A T 6: 136,911,566 V138E possibly damaging Het
Gbp4 G A 5: 105,119,919 A487V probably benign Het
Gm10142 C A 10: 77,716,123 T106N probably damaging Het
Gm11639 T A 11: 104,736,114 probably benign Het
Gxylt2 C A 6: 100,733,235 H112Q probably damaging Het
Hexim2 G A 11: 103,138,383 R87Q probably damaging Het
Hgf A G 5: 16,602,307 N399S probably benign Het
Ikbke T A 1: 131,271,779 I302F probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kdm1b A G 13: 47,063,146 probably null Het
Krtap19-9a T C 16: 88,924,114 noncoding transcript Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mmp10 G A 9: 7,503,620 A164T possibly damaging Het
Myrip G A 9: 120,424,668 G269D probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Paxbp1 G T 16: 91,030,496 R420S probably damaging Het
Pcbp2 T A 15: 102,483,162 S38R probably damaging Het
Pcf11 A G 7: 92,657,714 V1082A probably benign Het
Pkhd1 T C 1: 20,199,405 E3305G probably damaging Het
Pla2g4c T A 7: 13,340,618 W250R probably damaging Het
Prune2 A G 19: 17,016,361 probably null Het
Rpsa A G 9: 120,128,485 probably benign Het
Sema3e A G 5: 14,225,666 I262V probably benign Het
Setd2 T A 9: 110,567,758 L1663* probably null Het
Sh3d19 G A 3: 86,126,604 V755I probably benign Het
Smim4 A G 14: 31,124,520 probably null Het
Spag9 T A 11: 94,082,828 V14E possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sspo A T 6: 48,451,884 Q411L probably damaging Het
Sycp1 A C 3: 102,895,897 S532R probably benign Het
Taf6l C A 19: 8,774,846 A493S probably benign Het
Tsnaxip1 A G 8: 105,843,971 D574G probably benign Het
Ttll10 T A 4: 156,047,627 K117N possibly damaging Het
Vmn2r45 T A 7: 8,471,476 Y851F probably benign Het
Vps33a T C 5: 123,565,056 D168G probably damaging Het
Other mutations in Utp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01465:Utp4 APN 8 106894698 missense probably benign 0.02
IGL01871:Utp4 APN 8 106912317 missense probably benign
IGL02100:Utp4 APN 8 106898175 missense probably benign 0.00
IGL02501:Utp4 APN 8 106906241 missense probably benign 0.16
IGL02948:Utp4 APN 8 106894641 missense probably benign 0.31
IGL03210:Utp4 APN 8 106916256 missense probably benign
Cheyenne_canon UTSW 8 106912275 missense probably damaging 1.00
PIT4480001:Utp4 UTSW 8 106906185 missense probably benign 0.00
R0066:Utp4 UTSW 8 106922898 missense possibly damaging 0.70
R0066:Utp4 UTSW 8 106922898 missense possibly damaging 0.70
R0145:Utp4 UTSW 8 106894669 missense probably benign 0.02
R0158:Utp4 UTSW 8 106913386 missense probably null
R0360:Utp4 UTSW 8 106898537 unclassified probably benign
R0364:Utp4 UTSW 8 106898537 unclassified probably benign
R0382:Utp4 UTSW 8 106922935 missense probably benign 0.01
R0798:Utp4 UTSW 8 106922226 missense probably benign 0.00
R1164:Utp4 UTSW 8 106900844 critical splice acceptor site probably null
R1381:Utp4 UTSW 8 106906276 missense probably benign 0.02
R1440:Utp4 UTSW 8 106898053 unclassified probably benign
R1711:Utp4 UTSW 8 106918720 missense probably damaging 1.00
R1839:Utp4 UTSW 8 106913454 missense probably benign
R1903:Utp4 UTSW 8 106912350 critical splice donor site probably null
R2060:Utp4 UTSW 8 106898521 missense probably benign 0.33
R2938:Utp4 UTSW 8 106922929 missense probably damaging 1.00
R5526:Utp4 UTSW 8 106917633 missense possibly damaging 0.70
R5562:Utp4 UTSW 8 106922925 missense probably benign 0.00
R5764:Utp4 UTSW 8 106917616 missense possibly damaging 0.81
R6310:Utp4 UTSW 8 106918621 missense probably benign 0.16
R6478:Utp4 UTSW 8 106904446 critical splice donor site probably null
R6523:Utp4 UTSW 8 106898463 missense probably damaging 0.98
R7329:Utp4 UTSW 8 106913463 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGCACTGAGATTCCTGTCATAG -3'
(R):5'- CTGGCTAACTTTTCACTAAGGATTC -3'

Sequencing Primer
(F):5'- CTTGTTATAAGGTTTGCCAGCC -3'
(R):5'- AAGGATTCTTCCCAATTCATTGC -3'
Posted On2016-12-15