Incidental Mutation 'R5814:Arrdc3'
ID447705
Institutional Source Beutler Lab
Gene Symbol Arrdc3
Ensembl Gene ENSMUSG00000074794
Gene Namearrestin domain containing 3
SynonymsmKIAA1376; AI450344
MMRRC Submission 043396-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R5814 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location80883384-80896042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80890579 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 220 (R220L)
Ref Sequence ENSEMBL: ENSMUSP00000096957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099356] [ENSMUST00000159690] [ENSMUST00000161441]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099356
AA Change: R220L

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096957
Gene: ENSMUSG00000074794
AA Change: R220L

DomainStartEndE-ValueType
Pfam:Arrestin_N 9 165 3.4e-35 PFAM
Arrestin_C 187 314 1.25e-29 SMART
low complexity region 319 331 N/A INTRINSIC
low complexity region 335 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159090
Predicted Effect possibly damaging
Transcript: ENSMUST00000159690
AA Change: R220L

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124418
Gene: ENSMUSG00000074794
AA Change: R220L

DomainStartEndE-ValueType
Pfam:Arrestin_N 9 165 3.5e-38 PFAM
Arrestin_C 187 314 1.25e-29 SMART
low complexity region 319 331 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159856
Predicted Effect probably benign
Transcript: ENSMUST00000161441
SMART Domains Protein: ENSMUSP00000125455
Gene: ENSMUSG00000074794

DomainStartEndE-ValueType
Pfam:Arrestin_C 4 94 2e-10 PFAM
low complexity region 99 111 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162904
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 91% (52/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arrestin family of proteins, which regulate G protein-mediated signaling. The encoded protein is thought to act as a regulator of breast cancer growth and progression by binding to a phosphorylated form of integrin beta4, a tumor-related antigen, targeting the integrin for internalization and degradation. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit resistance to age-related obesity, insulin resistance, and hepatic steatosis. Mice homozygous for a different gene trap allele exhibit resistance to obesity, embryonic lethality when dams are fed a standard chow and dandruff due to very thin skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,082 D135G probably benign Het
9130409I23Rik G A 1: 181,055,098 V142I probably damaging Het
Bace1 A G 9: 45,860,264 D458G probably damaging Het
Cacna1s A G 1: 136,107,142 Y1360C probably benign Het
Ccnb1-ps T C 7: 42,107,098 noncoding transcript Het
Cd209b T C 8: 3,923,348 E112G probably damaging Het
Cit T A 5: 115,979,419 L1176Q probably damaging Het
Clcn3 T C 8: 60,934,573 Y214C probably damaging Het
Clvs2 G T 10: 33,528,507 Q238K probably benign Het
Creb3l3 C T 10: 81,085,662 V350M probably benign Het
Crot A C 5: 8,973,996 D373E probably damaging Het
Cyp4a12b T A 4: 115,432,497 I187N probably damaging Het
Dnhd1 C A 7: 105,719,895 A4291D possibly damaging Het
Dnmt3b A T 2: 153,672,497 E403D probably benign Het
Ect2l A T 10: 18,200,009 I43K probably damaging Het
Ep400 C A 5: 110,695,578 probably null Het
Erp27 A T 6: 136,911,566 V138E possibly damaging Het
Gbp4 G A 5: 105,119,919 A487V probably benign Het
Gm10142 C A 10: 77,716,123 T106N probably damaging Het
Gm11639 T A 11: 104,736,114 probably benign Het
Gxylt2 C A 6: 100,733,235 H112Q probably damaging Het
Hexim2 G A 11: 103,138,383 R87Q probably damaging Het
Hgf A G 5: 16,602,307 N399S probably benign Het
Ikbke T A 1: 131,271,779 I302F probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kdm1b A G 13: 47,063,146 probably null Het
Krtap19-9a T C 16: 88,924,114 noncoding transcript Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mmp10 G A 9: 7,503,620 A164T possibly damaging Het
Myrip G A 9: 120,424,668 G269D probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Paxbp1 G T 16: 91,030,496 R420S probably damaging Het
Pcbp2 T A 15: 102,483,162 S38R probably damaging Het
Pcf11 A G 7: 92,657,714 V1082A probably benign Het
Pkhd1 T C 1: 20,199,405 E3305G probably damaging Het
Pla2g4c T A 7: 13,340,618 W250R probably damaging Het
Prune2 A G 19: 17,016,361 probably null Het
Rpsa A G 9: 120,128,485 probably benign Het
Sema3e A G 5: 14,225,666 I262V probably benign Het
Setd2 T A 9: 110,567,758 L1663* probably null Het
Sh3d19 G A 3: 86,126,604 V755I probably benign Het
Smim4 A G 14: 31,124,520 probably null Het
Spag9 T A 11: 94,082,828 V14E possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sspo A T 6: 48,451,884 Q411L probably damaging Het
Sycp1 A C 3: 102,895,897 S532R probably benign Het
Taf6l C A 19: 8,774,846 A493S probably benign Het
Tsnaxip1 A G 8: 105,843,971 D574G probably benign Het
Ttll10 T A 4: 156,047,627 K117N possibly damaging Het
Utp4 T A 8: 106,912,275 I405K probably damaging Het
Vmn2r45 T A 7: 8,471,476 Y851F probably benign Het
Vps33a T C 5: 123,565,056 D168G probably damaging Het
Other mutations in Arrdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Arrdc3 APN 13 80890572 missense probably damaging 1.00
IGL00933:Arrdc3 APN 13 80891055 splice site probably benign
IGL02006:Arrdc3 APN 13 80883774 missense probably damaging 1.00
IGL02009:Arrdc3 APN 13 80893380 missense probably benign 0.20
IGL02272:Arrdc3 APN 13 80891650 splice site probably benign
IGL02634:Arrdc3 APN 13 80890765 missense probably damaging 1.00
IGL03337:Arrdc3 APN 13 80890647 missense probably benign 0.01
R0008:Arrdc3 UTSW 13 80891075 missense probably damaging 1.00
R0008:Arrdc3 UTSW 13 80883892 nonsense probably null
R0008:Arrdc3 UTSW 13 80891075 missense probably damaging 1.00
R0838:Arrdc3 UTSW 13 80889247 splice site probably benign
R0843:Arrdc3 UTSW 13 80890803 splice site probably benign
R1211:Arrdc3 UTSW 13 80890698 missense possibly damaging 0.76
R1404:Arrdc3 UTSW 13 80883854 missense probably damaging 1.00
R1404:Arrdc3 UTSW 13 80883854 missense probably damaging 1.00
R1992:Arrdc3 UTSW 13 80883689 missense probably damaging 1.00
R4446:Arrdc3 UTSW 13 80889063 intron probably benign
R4540:Arrdc3 UTSW 13 80890671 missense possibly damaging 0.95
R4718:Arrdc3 UTSW 13 80883867 missense possibly damaging 0.48
R5138:Arrdc3 UTSW 13 80891065 missense probably damaging 1.00
R6514:Arrdc3 UTSW 13 80889190 missense probably damaging 1.00
R6899:Arrdc3 UTSW 13 80889211 missense probably damaging 0.99
R6985:Arrdc3 UTSW 13 80883657 missense probably damaging 0.99
R7076:Arrdc3 UTSW 13 80890696 missense probably damaging 1.00
R7670:Arrdc3 UTSW 13 80889093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGAAGTCACTTTGCTCATG -3'
(R):5'- CATTAGCGAATATTCCACTCGG -3'

Sequencing Primer
(F):5'- GAAGTCACTTTGCTCATGTCCAGG -3'
(R):5'- CACTCGGATTATACTACAGTCGAGG -3'
Posted On2016-12-15