Incidental Mutation 'R5781:Pla2g4f'
ID447716
Institutional Source Beutler Lab
Gene Symbol Pla2g4f
Ensembl Gene ENSMUSG00000046971
Gene Namephospholipase A2, group IVF
Synonyms4732472I07Rik, Pla2zeta
MMRRC Submission 043378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5781 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120299957-120314165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120305023 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 390 (S390I)
Ref Sequence ENSEMBL: ENSMUSP00000062607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054651]
Predicted Effect probably damaging
Transcript: ENSMUST00000054651
AA Change: S390I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000062607
Gene: ENSMUSG00000046971
AA Change: S390I

DomainStartEndE-ValueType
C2 45 144 7.51e-11 SMART
PLAc 285 797 1.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142183
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,101,987 L1617P probably damaging Het
Abhd16b T C 2: 181,494,154 V283A probably damaging Het
Adamts19 G T 18: 58,837,968 R208L possibly damaging Het
Adamts4 T C 1: 171,251,015 I56T possibly damaging Het
Alpk1 A C 3: 127,680,035 V773G possibly damaging Het
Arhgap10 G T 8: 77,450,707 Q100K possibly damaging Het
Arhgef18 T A 8: 3,439,439 probably null Het
Asb15 A T 6: 24,564,378 H277L probably benign Het
Ascc3 T A 10: 50,637,978 V291E probably damaging Het
Cnot6l A C 5: 96,086,165 V329G probably benign Het
Col14a1 A G 15: 55,423,512 T910A unknown Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dsc2 A G 18: 20,032,510 I846T probably benign Het
Evc A T 5: 37,326,570 S129T probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fyco1 A G 9: 123,794,833 V1377A probably damaging Het
Haus6 C T 4: 86,601,263 A203T possibly damaging Het
Hkdc1 T G 10: 62,417,933 D23A probably damaging Het
Hpdl C T 4: 116,820,578 V229M probably damaging Het
Hspa12a T C 19: 58,822,086 Y175C probably damaging Het
Hyal1 C T 9: 107,577,667 P59S probably damaging Het
Itpr1 G A 6: 108,510,738 C2374Y probably benign Het
Kmt2a A T 9: 44,847,842 Y114* probably null Het
Mc2r A T 18: 68,407,395 Y276N possibly damaging Het
Mc2r A T 18: 68,407,397 I275K probably damaging Het
Mlycd A G 8: 119,410,280 Y413C probably damaging Het
Mocs2 T G 13: 114,820,919 S86R probably damaging Het
Msx2 C A 13: 53,472,608 A35S probably benign Het
Olfr770 A T 10: 129,133,147 L207H probably damaging Het
Plcl1 C T 1: 55,695,989 A163V possibly damaging Het
Pnn T C 12: 59,071,819 V396A probably damaging Het
Rbmxl1 G A 8: 78,505,641 probably benign Het
Recql G T 6: 142,365,618 probably null Het
Rev3l T A 10: 39,823,093 N1195K probably benign Het
Rfwd3 G A 8: 111,273,084 T754M probably benign Het
Sctr A G 1: 120,031,620 T98A probably damaging Het
Sdk1 T A 5: 141,936,048 D6E probably benign Het
Smpdl3a T A 10: 57,807,938 I264K possibly damaging Het
Spag6 A G 2: 18,731,993 I154V probably benign Het
Tbc1d12 A C 19: 38,882,683 T297P probably benign Het
Tgfb1 A G 7: 25,696,960 D226G probably benign Het
Ubr3 G T 2: 70,016,244 probably null Het
Ubr4 T C 4: 139,468,096 Y1210H probably damaging Het
Ubr5 T C 15: 38,006,541 T1157A probably benign Het
Vmn2r120 T G 17: 57,524,938 T284P probably benign Het
Vps13b G T 15: 35,794,035 A2286S probably damaging Het
Zcchc14 A T 8: 121,604,593 probably benign Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Other mutations in Pla2g4f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Pla2g4f APN 2 120302738 missense possibly damaging 0.53
IGL01652:Pla2g4f APN 2 120302235 missense possibly damaging 0.86
IGL02792:Pla2g4f APN 2 120303369 missense probably damaging 1.00
R0625:Pla2g4f UTSW 2 120305041 missense probably damaging 1.00
R1760:Pla2g4f UTSW 2 120314066 unclassified probably benign
R1799:Pla2g4f UTSW 2 120311068 missense possibly damaging 0.49
R2212:Pla2g4f UTSW 2 120303106 missense probably benign
R2351:Pla2g4f UTSW 2 120300442 missense probably benign 0.01
R3412:Pla2g4f UTSW 2 120303106 missense probably benign
R3414:Pla2g4f UTSW 2 120303106 missense probably benign
R3906:Pla2g4f UTSW 2 120300499 missense probably benign 0.28
R4084:Pla2g4f UTSW 2 120312325 missense probably benign 0.36
R4477:Pla2g4f UTSW 2 120303672 missense probably damaging 1.00
R4529:Pla2g4f UTSW 2 120300619 missense probably damaging 0.99
R4606:Pla2g4f UTSW 2 120313986 missense probably benign 0.00
R4685:Pla2g4f UTSW 2 120305015 missense probably damaging 1.00
R4728:Pla2g4f UTSW 2 120300921 missense probably benign 0.19
R4782:Pla2g4f UTSW 2 120303276 missense probably damaging 1.00
R4957:Pla2g4f UTSW 2 120300499 missense probably benign 0.28
R6158:Pla2g4f UTSW 2 120301071 missense probably benign 0.21
R6232:Pla2g4f UTSW 2 120302221 missense possibly damaging 0.63
R6629:Pla2g4f UTSW 2 120308242 missense probably damaging 1.00
R6894:Pla2g4f UTSW 2 120303596 missense probably benign 0.44
R6939:Pla2g4f UTSW 2 120307301 missense probably damaging 1.00
R7131:Pla2g4f UTSW 2 120304554 missense probably null 0.01
R7221:Pla2g4f UTSW 2 120300995 missense probably benign 0.06
R7421:Pla2g4f UTSW 2 120307256 missense probably benign 0.07
R7767:Pla2g4f UTSW 2 120305009 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GAGTTAGAGGACAGATCTCCCC -3'
(R):5'- TGCCGTGGATAAGCAGTAATAC -3'

Sequencing Primer
(F):5'- AGGACAGATCTCCCCCTGGTAC -3'
(R):5'- TGGATAAGCAGTAATACATACAGCC -3'
Posted On2016-12-15