Incidental Mutation 'R5781:Haus6'
ID447719
Institutional Source Beutler Lab
Gene Symbol Haus6
Ensembl Gene ENSMUSG00000038047
Gene NameHAUS augmin-like complex, subunit 6
Synonyms6230416J20Rik, D4Ertd27e
MMRRC Submission 043378-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.722) question?
Stock #R5781 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location86578855-86612055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86601263 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 203 (A203T)
Ref Sequence ENSEMBL: ENSMUSP00000070504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070607] [ENSMUST00000125481]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070607
AA Change: A203T

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070504
Gene: ENSMUSG00000038047
AA Change: A203T

DomainStartEndE-ValueType
Pfam:HAUS6_N 14 238 1.1e-77 PFAM
low complexity region 613 624 N/A INTRINSIC
low complexity region 771 785 N/A INTRINSIC
low complexity region 915 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123432
Predicted Effect probably benign
Transcript: ENSMUST00000125481
SMART Domains Protein: ENSMUSP00000118609
Gene: ENSMUSG00000038047

DomainStartEndE-ValueType
Pfam:HAUS6_N 43 69 2.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128381
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the augmin complex. The augmin complex plays a role in microtubule attachment to the kinetochore and central spindle formation. This protein may have a role in efficient chromosome congression and segregation by promoting microtubule-dependent microtubule amplification. Pseudogenes of this gene are located on chromosomes 7 and 20. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E2.5 and E7.5 with delayed or incomplete clustering of microtubule-organizing centers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,101,987 L1617P probably damaging Het
Abhd16b T C 2: 181,494,154 V283A probably damaging Het
Adamts19 G T 18: 58,837,968 R208L possibly damaging Het
Adamts4 T C 1: 171,251,015 I56T possibly damaging Het
Alpk1 A C 3: 127,680,035 V773G possibly damaging Het
Arhgap10 G T 8: 77,450,707 Q100K possibly damaging Het
Arhgef18 T A 8: 3,439,439 probably null Het
Asb15 A T 6: 24,564,378 H277L probably benign Het
Ascc3 T A 10: 50,637,978 V291E probably damaging Het
Cnot6l A C 5: 96,086,165 V329G probably benign Het
Col14a1 A G 15: 55,423,512 T910A unknown Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dsc2 A G 18: 20,032,510 I846T probably benign Het
Evc A T 5: 37,326,570 S129T probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fyco1 A G 9: 123,794,833 V1377A probably damaging Het
Hkdc1 T G 10: 62,417,933 D23A probably damaging Het
Hpdl C T 4: 116,820,578 V229M probably damaging Het
Hspa12a T C 19: 58,822,086 Y175C probably damaging Het
Hyal1 C T 9: 107,577,667 P59S probably damaging Het
Itpr1 G A 6: 108,510,738 C2374Y probably benign Het
Kmt2a A T 9: 44,847,842 Y114* probably null Het
Mc2r A T 18: 68,407,395 Y276N possibly damaging Het
Mc2r A T 18: 68,407,397 I275K probably damaging Het
Mlycd A G 8: 119,410,280 Y413C probably damaging Het
Mocs2 T G 13: 114,820,919 S86R probably damaging Het
Msx2 C A 13: 53,472,608 A35S probably benign Het
Olfr770 A T 10: 129,133,147 L207H probably damaging Het
Pla2g4f C A 2: 120,305,023 S390I probably damaging Het
Plcl1 C T 1: 55,695,989 A163V possibly damaging Het
Pnn T C 12: 59,071,819 V396A probably damaging Het
Rbmxl1 G A 8: 78,505,641 probably benign Het
Recql G T 6: 142,365,618 probably null Het
Rev3l T A 10: 39,823,093 N1195K probably benign Het
Rfwd3 G A 8: 111,273,084 T754M probably benign Het
Sctr A G 1: 120,031,620 T98A probably damaging Het
Sdk1 T A 5: 141,936,048 D6E probably benign Het
Smpdl3a T A 10: 57,807,938 I264K possibly damaging Het
Spag6 A G 2: 18,731,993 I154V probably benign Het
Tbc1d12 A C 19: 38,882,683 T297P probably benign Het
Tgfb1 A G 7: 25,696,960 D226G probably benign Het
Ubr3 G T 2: 70,016,244 probably null Het
Ubr4 T C 4: 139,468,096 Y1210H probably damaging Het
Ubr5 T C 15: 38,006,541 T1157A probably benign Het
Vmn2r120 T G 17: 57,524,938 T284P probably benign Het
Vps13b G T 15: 35,794,035 A2286S probably damaging Het
Zcchc14 A T 8: 121,604,593 probably benign Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Other mutations in Haus6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Haus6 APN 4 86607981 missense probably benign 0.32
IGL02307:Haus6 APN 4 86583835 missense possibly damaging 0.53
IGL03113:Haus6 APN 4 86583106 nonsense probably null
IGL03384:Haus6 APN 4 86583525 missense probably benign
R0436:Haus6 UTSW 4 86585807 missense probably benign 0.00
R0491:Haus6 UTSW 4 86602846 missense possibly damaging 0.93
R0620:Haus6 UTSW 4 86583514 missense possibly damaging 0.53
R1118:Haus6 UTSW 4 86585326 critical splice donor site probably null
R1969:Haus6 UTSW 4 86604246 missense probably damaging 0.99
R1985:Haus6 UTSW 4 86593609 missense possibly damaging 0.96
R2213:Haus6 UTSW 4 86581992 missense possibly damaging 0.53
R2448:Haus6 UTSW 4 86589001 missense possibly damaging 0.53
R2567:Haus6 UTSW 4 86585885 nonsense probably null
R2760:Haus6 UTSW 4 86583176 nonsense probably null
R3714:Haus6 UTSW 4 86602867 missense probably benign 0.01
R3962:Haus6 UTSW 4 86611804 missense possibly damaging 0.85
R4180:Haus6 UTSW 4 86583574 missense probably benign 0.00
R4736:Haus6 UTSW 4 86600749 critical splice donor site probably null
R4738:Haus6 UTSW 4 86600749 critical splice donor site probably null
R4929:Haus6 UTSW 4 86595433 missense probably benign 0.03
R4933:Haus6 UTSW 4 86585287 intron probably benign
R5027:Haus6 UTSW 4 86605696 missense possibly damaging 0.92
R5199:Haus6 UTSW 4 86582985 missense possibly damaging 0.85
R5240:Haus6 UTSW 4 86583178 missense possibly damaging 0.86
R5580:Haus6 UTSW 4 86599266 missense possibly damaging 0.73
R5865:Haus6 UTSW 4 86586357 missense possibly damaging 0.73
R5926:Haus6 UTSW 4 86599316 missense probably benign
R6154:Haus6 UTSW 4 86583756 missense possibly damaging 0.96
R7166:Haus6 UTSW 4 86583687 missense possibly damaging 0.72
R7183:Haus6 UTSW 4 86583752 missense possibly damaging 0.53
R7418:Haus6 UTSW 4 86594773 missense possibly damaging 0.73
R7843:Haus6 UTSW 4 86586341 missense possibly damaging 0.85
R7926:Haus6 UTSW 4 86586341 missense possibly damaging 0.85
Z1088:Haus6 UTSW 4 86602874 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CTCATCATATGGCTCCATTCTAATAAA -3'
(R):5'- GACTGTCAAGAATTTGGTTGTATCTT -3'

Sequencing Primer
(F):5'- GCCTTTAATCTGAAGCTCAGTAGGC -3'
(R):5'- GCGCTTCATACTGTGTCACTAGAAG -3'
Posted On2016-12-15