Incidental Mutation 'R0545:Olfr394'
ID44772
Institutional Source Beutler Lab
Gene Symbol Olfr394
Ensembl Gene ENSMUSG00000056921
Gene Nameolfactory receptor 394
SynonymsMOR135-8, GA_x6K02T2P1NL-4043306-4042374
MMRRC Submission 038737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R0545 (G1)
Quality Score205
Status Validated
Chromosome11
Chromosomal Location73883337-73890771 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 73888017 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 118 (Y118*)
Ref Sequence ENSEMBL: ENSMUSP00000149527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071478] [ENSMUST00000214284] [ENSMUST00000216608]
Predicted Effect probably null
Transcript: ENSMUST00000071478
AA Change: Y118*
SMART Domains Protein: ENSMUSP00000071415
Gene: ENSMUSG00000056921
AA Change: Y118*

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.4e-55 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4e-7 PFAM
Pfam:7tm_1 39 288 1.9e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214284
AA Change: Y118*
Predicted Effect probably null
Transcript: ENSMUST00000216608
AA Change: Y118*
Meta Mutation Damage Score 0.9701 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,542,376 R76H probably damaging Het
4932438A13Rik G A 3: 36,987,690 probably benign Het
Adnp2 T C 18: 80,129,401 I598V probably benign Het
Ago3 T C 4: 126,417,232 N63D probably damaging Het
Alkbh7 C T 17: 56,999,012 R138* probably null Het
Atp6ap1l T C 13: 90,883,663 H300R probably benign Het
BC051076 C T 5: 87,963,490 noncoding transcript Het
Bpifb9a T A 2: 154,261,950 C104* probably null Het
Cacna2d2 T C 9: 107,525,223 L826P probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Ccdc88c T C 12: 100,947,188 D526G probably damaging Het
Cdh23 T A 10: 60,331,291 T1861S probably benign Het
Ces2f A C 8: 104,950,036 M121L possibly damaging Het
Cfap58 G A 19: 47,941,097 probably benign Het
Chpf2 T C 5: 24,590,324 S282P possibly damaging Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Cma2 A T 14: 55,973,113 M86L probably benign Het
Cog6 A T 3: 52,996,075 M134K probably damaging Het
Col1a1 A G 11: 94,951,594 D1446G unknown Het
Cpne8 T A 15: 90,497,075 D512V probably damaging Het
Ctnna2 T A 6: 77,605,182 N352I probably damaging Het
Cyp2c69 A C 19: 39,886,661 L16R probably damaging Het
Dysf T C 6: 84,099,461 S603P probably damaging Het
Epha5 A G 5: 84,067,358 probably null Het
Ercc3 T C 18: 32,245,902 S270P probably damaging Het
F10 T A 8: 13,048,249 C151S probably damaging Het
Gpr180 T G 14: 118,160,046 H317Q possibly damaging Het
Gstp2 T C 19: 4,041,633 E32G possibly damaging Het
Ikzf5 T C 7: 131,392,500 T133A possibly damaging Het
Itch G T 2: 155,182,298 G274* probably null Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Lama3 T A 18: 12,561,701 S1295T possibly damaging Het
Lipc A G 9: 70,812,705 L255P probably damaging Het
Lrrc38 A G 4: 143,350,758 D197G probably benign Het
Mfap2 A G 4: 141,014,185 probably benign Het
Mfhas1 A G 8: 35,589,048 K226E probably damaging Het
Morc1 A G 16: 48,565,657 R548G probably benign Het
Mrgprb5 T C 7: 48,168,885 N34S probably benign Het
Mroh4 T C 15: 74,625,427 T182A probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo5a T C 9: 75,167,037 F743L possibly damaging Het
Notch4 A C 17: 34,583,433 D1276A probably damaging Het
Olfr139 A G 11: 74,045,047 C76R possibly damaging Het
Olfr215 T A 6: 116,582,656 I97L probably benign Het
Olfr799 T A 10: 129,647,349 C74S probably damaging Het
Plin4 T A 17: 56,106,567 T353S probably damaging Het
Ppp1r9a A G 6: 5,115,357 T827A probably benign Het
Prlr C T 15: 10,317,566 T40I probably damaging Het
Psme3 T C 11: 101,319,904 probably benign Het
Pygb A T 2: 150,815,706 D363V probably benign Het
Rsph6a C T 7: 19,054,946 Q68* probably null Het
Serpini2 A G 3: 75,258,138 V178A probably benign Het
Sh2d2a T C 3: 87,851,888 probably benign Het
Skint7 A C 4: 111,980,198 M58L probably benign Het
Slco3a1 G T 7: 74,320,553 Y435* probably null Het
Stk17b T C 1: 53,762,583 probably benign Het
Tinag T A 9: 77,031,710 H162L possibly damaging Het
Ttc21a T A 9: 119,958,799 L811Q probably damaging Het
Ttc41 A T 10: 86,759,097 M912L probably benign Het
Vmn2r98 G T 17: 19,053,613 V41F probably benign Het
Washc5 C T 15: 59,342,093 C838Y possibly damaging Het
Wrnip1 A G 13: 32,806,813 T352A probably damaging Het
Zan A C 5: 137,396,177 C4467G unknown Het
Zc3h7a T C 16: 11,152,333 probably benign Het
Zfp729a C A 13: 67,620,226 C628F probably benign Het
Other mutations in Olfr394
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Olfr394 APN 11 73888249 missense probably damaging 1.00
IGL01655:Olfr394 APN 11 73887927 missense probably benign 0.01
IGL02173:Olfr394 APN 11 73888123 missense possibly damaging 0.72
IGL02308:Olfr394 APN 11 73888295 missense probably benign 0.09
IGL02656:Olfr394 APN 11 73888039 missense probably damaging 0.98
R0079:Olfr394 UTSW 11 73887737 missense probably benign 0.22
R0119:Olfr394 UTSW 11 73887830 missense probably benign 0.11
R0136:Olfr394 UTSW 11 73887785 missense probably benign 0.00
R0136:Olfr394 UTSW 11 73887830 missense probably benign 0.11
R0255:Olfr394 UTSW 11 73887829 missense probably benign
R0599:Olfr394 UTSW 11 73887904 missense probably benign 0.19
R0655:Olfr394 UTSW 11 73887805 missense possibly damaging 0.88
R0657:Olfr394 UTSW 11 73887785 missense probably benign 0.00
R0657:Olfr394 UTSW 11 73887830 missense probably benign 0.11
R0720:Olfr394 UTSW 11 73887862 missense probably benign 0.12
R1112:Olfr394 UTSW 11 73888234 missense probably damaging 0.99
R2353:Olfr394 UTSW 11 73887834 missense probably benign 0.02
R2924:Olfr394 UTSW 11 73887511 missense probably damaging 0.99
R4583:Olfr394 UTSW 11 73887803 missense probably damaging 1.00
R5231:Olfr394 UTSW 11 73887955 missense probably damaging 1.00
R5537:Olfr394 UTSW 11 73887697 missense probably benign 0.02
R5806:Olfr394 UTSW 11 73887547 missense probably damaging 0.99
R7131:Olfr394 UTSW 11 73887954 nonsense probably null
R7325:Olfr394 UTSW 11 73888275 missense probably benign 0.19
R7361:Olfr394 UTSW 11 73888001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCAGGCCAGCTTTAAGAGAAC -3'
(R):5'- CACACACCAATGTACTTGTTTCTCAGC -3'

Sequencing Primer
(F):5'- GCCAGCTTTAAGAGAACAAATATGTC -3'
(R):5'- ATGTACTTGTTTCTCAGCAATTTGTC -3'
Posted On2013-06-11