Incidental Mutation 'R5781:Dhdds'
ID447721
Institutional Source Beutler Lab
Gene Symbol Dhdds
Ensembl Gene ENSMUSG00000012117
Gene Namedehydrodolichyl diphosphate synthase
Synonyms
MMRRC Submission 043378-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5781 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location133969028-134000918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 133996830 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 58 (L58F)
Ref Sequence ENSEMBL: ENSMUSP00000116098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012262] [ENSMUST00000105885] [ENSMUST00000105886] [ENSMUST00000105887] [ENSMUST00000105889] [ENSMUST00000130464] [ENSMUST00000144668]
Predicted Effect probably damaging
Transcript: ENSMUST00000012262
AA Change: L58F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000012262
Gene: ENSMUSG00000012117
AA Change: L58F

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 256 1.5e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105885
AA Change: L58F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101509
Gene: ENSMUSG00000012117
AA Change: L58F

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 149 5.2e-42 PFAM
Pfam:Prenyltransf 145 222 1.4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105886
AA Change: L58F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101510
Gene: ENSMUSG00000012117
AA Change: L58F

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 109 9.8e-32 PFAM
Pfam:Prenyltransf 104 217 6.2e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105887
AA Change: L58F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101511
Gene: ENSMUSG00000012117
AA Change: L58F

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 255 6.4e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105889
AA Change: L58F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101512
Gene: ENSMUSG00000012117
AA Change: L58F

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 256 5.6e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130464
SMART Domains Protein: ENSMUSP00000121656
Gene: ENSMUSG00000012117

DomainStartEndE-ValueType
Pfam:Prenyltransf 1 54 1.8e-8 PFAM
Pfam:Prenyltransf 50 99 2.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142660
Predicted Effect probably damaging
Transcript: ENSMUST00000144668
AA Change: L58F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116098
Gene: ENSMUSG00000012117
AA Change: L58F

DomainStartEndE-ValueType
Pfam:Prenyltransf 32 256 1.5e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150729
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes cis-prenyl chain elongation to produce the polyprenyl backbone of dolichol, a glycosyl carrier lipid required for the biosynthesis of several classes of glycoproteins. Mutations in this gene are associated with retinitis pigmentosa type 59. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,101,987 L1617P probably damaging Het
Abhd16b T C 2: 181,494,154 V283A probably damaging Het
Adamts19 G T 18: 58,837,968 R208L possibly damaging Het
Adamts4 T C 1: 171,251,015 I56T possibly damaging Het
Alpk1 A C 3: 127,680,035 V773G possibly damaging Het
Arhgap10 G T 8: 77,450,707 Q100K possibly damaging Het
Arhgef18 T A 8: 3,439,439 probably null Het
Asb15 A T 6: 24,564,378 H277L probably benign Het
Ascc3 T A 10: 50,637,978 V291E probably damaging Het
Cnot6l A C 5: 96,086,165 V329G probably benign Het
Col14a1 A G 15: 55,423,512 T910A unknown Het
Dsc2 A G 18: 20,032,510 I846T probably benign Het
Evc A T 5: 37,326,570 S129T probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fyco1 A G 9: 123,794,833 V1377A probably damaging Het
Haus6 C T 4: 86,601,263 A203T possibly damaging Het
Hkdc1 T G 10: 62,417,933 D23A probably damaging Het
Hpdl C T 4: 116,820,578 V229M probably damaging Het
Hspa12a T C 19: 58,822,086 Y175C probably damaging Het
Hyal1 C T 9: 107,577,667 P59S probably damaging Het
Itpr1 G A 6: 108,510,738 C2374Y probably benign Het
Kmt2a A T 9: 44,847,842 Y114* probably null Het
Mc2r A T 18: 68,407,395 Y276N possibly damaging Het
Mc2r A T 18: 68,407,397 I275K probably damaging Het
Mlycd A G 8: 119,410,280 Y413C probably damaging Het
Mocs2 T G 13: 114,820,919 S86R probably damaging Het
Msx2 C A 13: 53,472,608 A35S probably benign Het
Olfr770 A T 10: 129,133,147 L207H probably damaging Het
Pla2g4f C A 2: 120,305,023 S390I probably damaging Het
Plcl1 C T 1: 55,695,989 A163V possibly damaging Het
Pnn T C 12: 59,071,819 V396A probably damaging Het
Rbmxl1 G A 8: 78,505,641 probably benign Het
Recql G T 6: 142,365,618 probably null Het
Rev3l T A 10: 39,823,093 N1195K probably benign Het
Rfwd3 G A 8: 111,273,084 T754M probably benign Het
Sctr A G 1: 120,031,620 T98A probably damaging Het
Sdk1 T A 5: 141,936,048 D6E probably benign Het
Smpdl3a T A 10: 57,807,938 I264K possibly damaging Het
Spag6 A G 2: 18,731,993 I154V probably benign Het
Tbc1d12 A C 19: 38,882,683 T297P probably benign Het
Tgfb1 A G 7: 25,696,960 D226G probably benign Het
Ubr3 G T 2: 70,016,244 probably null Het
Ubr4 T C 4: 139,468,096 Y1210H probably damaging Het
Ubr5 T C 15: 38,006,541 T1157A probably benign Het
Vmn2r120 T G 17: 57,524,938 T284P probably benign Het
Vps13b G T 15: 35,794,035 A2286S probably damaging Het
Zcchc14 A T 8: 121,604,593 probably benign Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Other mutations in Dhdds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Dhdds APN 4 134000260 splice site probably benign
IGL01566:Dhdds APN 4 133991337 missense probably damaging 0.99
IGL03024:Dhdds APN 4 133982849 missense probably damaging 1.00
IGL03115:Dhdds APN 4 133982871 missense probably benign
LCD18:Dhdds UTSW 4 133970363 utr 3 prime probably benign
R0622:Dhdds UTSW 4 133994236 missense probably damaging 1.00
R2036:Dhdds UTSW 4 133971099 missense probably damaging 1.00
R5284:Dhdds UTSW 4 133980212 missense probably benign 0.06
R5444:Dhdds UTSW 4 133971136 nonsense probably null
R5780:Dhdds UTSW 4 133996830 missense probably damaging 1.00
R6723:Dhdds UTSW 4 133994265 missense probably damaging 1.00
R7362:Dhdds UTSW 4 133971130 missense probably benign 0.04
R7496:Dhdds UTSW 4 133971254 missense possibly damaging 0.96
R7696:Dhdds UTSW 4 133996914 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGTCTTCAAATCACTCACTC -3'
(R):5'- GCTGATGATGCTGACCTAGTAG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCAGGAGG -3'
(R):5'- CCTAGTAGGTAAGGATGCCACGTTC -3'
Posted On2016-12-15