Incidental Mutation 'R5781:Pnn'
ID447748
Institutional Source Beutler Lab
Gene Symbol Pnn
Ensembl Gene ENSMUSG00000020994
Gene Namepinin
SynonymsD12Ertd512e
MMRRC Submission 043378-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5781 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location59066884-59073998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59071819 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 396 (V396A)
Ref Sequence ENSEMBL: ENSMUSP00000021381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021381] [ENSMUST00000219176]
Predicted Effect probably damaging
Transcript: ENSMUST00000021381
AA Change: V396A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021381
Gene: ENSMUSG00000020994
AA Change: V396A

DomainStartEndE-ValueType
Pfam:Pinin_SDK_N 1 132 3.7e-61 PFAM
Pfam:Pinin_SDK_memA 136 261 7.8e-38 PFAM
coiled coil region 290 374 N/A INTRINSIC
low complexity region 451 508 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
internal_repeat_1 559 572 9.16e-7 PROSPERO
internal_repeat_1 563 576 9.16e-7 PROSPERO
low complexity region 579 647 N/A INTRINSIC
low complexity region 651 665 N/A INTRINSIC
low complexity region 671 682 N/A INTRINSIC
low complexity region 695 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217773
Predicted Effect probably benign
Transcript: ENSMUST00000219176
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die prior to implantation. Mice homozygous for a hypomorphic allele show complete perinatal lethality, edema, axial skeletal abnormalities, cardiac outflow tract defects, cleft palate, and impaired development of the dorsal dermis and brown fat tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,101,987 L1617P probably damaging Het
Abhd16b T C 2: 181,494,154 V283A probably damaging Het
Adamts19 G T 18: 58,837,968 R208L possibly damaging Het
Adamts4 T C 1: 171,251,015 I56T possibly damaging Het
Alpk1 A C 3: 127,680,035 V773G possibly damaging Het
Arhgap10 G T 8: 77,450,707 Q100K possibly damaging Het
Arhgef18 T A 8: 3,439,439 probably null Het
Asb15 A T 6: 24,564,378 H277L probably benign Het
Ascc3 T A 10: 50,637,978 V291E probably damaging Het
Cnot6l A C 5: 96,086,165 V329G probably benign Het
Col14a1 A G 15: 55,423,512 T910A unknown Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dsc2 A G 18: 20,032,510 I846T probably benign Het
Evc A T 5: 37,326,570 S129T probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fyco1 A G 9: 123,794,833 V1377A probably damaging Het
Haus6 C T 4: 86,601,263 A203T possibly damaging Het
Hkdc1 T G 10: 62,417,933 D23A probably damaging Het
Hpdl C T 4: 116,820,578 V229M probably damaging Het
Hspa12a T C 19: 58,822,086 Y175C probably damaging Het
Hyal1 C T 9: 107,577,667 P59S probably damaging Het
Itpr1 G A 6: 108,510,738 C2374Y probably benign Het
Kmt2a A T 9: 44,847,842 Y114* probably null Het
Mc2r A T 18: 68,407,395 Y276N possibly damaging Het
Mc2r A T 18: 68,407,397 I275K probably damaging Het
Mlycd A G 8: 119,410,280 Y413C probably damaging Het
Mocs2 T G 13: 114,820,919 S86R probably damaging Het
Msx2 C A 13: 53,472,608 A35S probably benign Het
Olfr770 A T 10: 129,133,147 L207H probably damaging Het
Pla2g4f C A 2: 120,305,023 S390I probably damaging Het
Plcl1 C T 1: 55,695,989 A163V possibly damaging Het
Rbmxl1 G A 8: 78,505,641 probably benign Het
Recql G T 6: 142,365,618 probably null Het
Rev3l T A 10: 39,823,093 N1195K probably benign Het
Rfwd3 G A 8: 111,273,084 T754M probably benign Het
Sctr A G 1: 120,031,620 T98A probably damaging Het
Sdk1 T A 5: 141,936,048 D6E probably benign Het
Smpdl3a T A 10: 57,807,938 I264K possibly damaging Het
Spag6 A G 2: 18,731,993 I154V probably benign Het
Tbc1d12 A C 19: 38,882,683 T297P probably benign Het
Tgfb1 A G 7: 25,696,960 D226G probably benign Het
Ubr3 G T 2: 70,016,244 probably null Het
Ubr4 T C 4: 139,468,096 Y1210H probably damaging Het
Ubr5 T C 15: 38,006,541 T1157A probably benign Het
Vmn2r120 T G 17: 57,524,938 T284P probably benign Het
Vps13b G T 15: 35,794,035 A2286S probably damaging Het
Zcchc14 A T 8: 121,604,593 probably benign Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Other mutations in Pnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02267:Pnn APN 12 59070209 missense probably damaging 1.00
R0350:Pnn UTSW 12 59067117 critical splice donor site probably null
R1853:Pnn UTSW 12 59071613 missense probably damaging 0.99
R1854:Pnn UTSW 12 59071613 missense probably damaging 0.99
R4287:Pnn UTSW 12 59072170 missense possibly damaging 0.86
R4792:Pnn UTSW 12 59072205 missense possibly damaging 0.86
R4812:Pnn UTSW 12 59071618 missense possibly damaging 0.94
R4933:Pnn UTSW 12 59070227 missense probably damaging 1.00
R5541:Pnn UTSW 12 59071930 missense possibly damaging 0.50
R5716:Pnn UTSW 12 59071872 missense probably benign 0.00
R5963:Pnn UTSW 12 59067831 nonsense probably null
R6877:Pnn UTSW 12 59068767 missense probably damaging 1.00
R6999:Pnn UTSW 12 59070299 critical splice donor site probably null
R7372:Pnn UTSW 12 59068979 missense probably damaging 1.00
R7458:Pnn UTSW 12 59072414 missense unknown
R7535:Pnn UTSW 12 59072137 missense probably benign 0.00
Z1177:Pnn UTSW 12 59072799 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCATCAGGTGGTGCGTAATG -3'
(R):5'- TGGCAAAGTCTCAGGCTGAC -3'

Sequencing Primer
(F):5'- CAGGTAATCAGCACAATGATGTAG -3'
(R):5'- TCTCAGGCTGACAGAGAGGC -3'
Posted On2016-12-15