Mutagenetix > Incidental Mutation

Incidental Mutation 'R5781:Adamts19'

447757

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

043378-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5781 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 58837968 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 208 (R208L)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052907
AA Change: R208L

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: R208L

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,101,987	L1617P	probably damaging	Het
Abhd16b	T	C	2: 181,494,154	V283A	probably damaging	Het
Adamts4	T	C	1: 171,251,015	I56T	possibly damaging	Het
Alpk1	A	C	3: 127,680,035	V773G	possibly damaging	Het
Arhgap10	G	T	8: 77,450,707	Q100K	possibly damaging	Het
Arhgef18	T	A	8: 3,439,439		probably null	Het
Asb15	A	T	6: 24,564,378	H277L	probably benign	Het
Ascc3	T	A	10: 50,637,978	V291E	probably damaging	Het
Cnot6l	A	C	5: 96,086,165	V329G	probably benign	Het
Col14a1	A	G	15: 55,423,512	T910A	unknown	Het
Dhdds	G	A	4: 133,996,830	L58F	probably damaging	Het
Dsc2	A	G	18: 20,032,510	I846T	probably benign	Het
Evc	A	T	5: 37,326,570	S129T	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Fyco1	A	G	9: 123,794,833	V1377A	probably damaging	Het
Haus6	C	T	4: 86,601,263	A203T	possibly damaging	Het
Hkdc1	T	G	10: 62,417,933	D23A	probably damaging	Het
Hpdl	C	T	4: 116,820,578	V229M	probably damaging	Het
Hspa12a	T	C	19: 58,822,086	Y175C	probably damaging	Het
Hyal1	C	T	9: 107,577,667	P59S	probably damaging	Het
Itpr1	G	A	6: 108,510,738	C2374Y	probably benign	Het
Kmt2a	A	T	9: 44,847,842	Y114*	probably null	Het
Mc2r	A	T	18: 68,407,395	Y276N	possibly damaging	Het
Mc2r	A	T	18: 68,407,397	I275K	probably damaging	Het
Mlycd	A	G	8: 119,410,280	Y413C	probably damaging	Het
Mocs2	T	G	13: 114,820,919	S86R	probably damaging	Het
Msx2	C	A	13: 53,472,608	A35S	probably benign	Het
Olfr770	A	T	10: 129,133,147	L207H	probably damaging	Het
Pla2g4f	C	A	2: 120,305,023	S390I	probably damaging	Het
Plcl1	C	T	1: 55,695,989	A163V	possibly damaging	Het
Pnn	T	C	12: 59,071,819	V396A	probably damaging	Het
Rbmxl1	G	A	8: 78,505,641		probably benign	Het
Recql	G	T	6: 142,365,618		probably null	Het
Rev3l	T	A	10: 39,823,093	N1195K	probably benign	Het
Rfwd3	G	A	8: 111,273,084	T754M	probably benign	Het
Sctr	A	G	1: 120,031,620	T98A	probably damaging	Het
Sdk1	T	A	5: 141,936,048	D6E	probably benign	Het
Smpdl3a	T	A	10: 57,807,938	I264K	possibly damaging	Het
Spag6	A	G	2: 18,731,993	I154V	probably benign	Het
Tbc1d12	A	C	19: 38,882,683	T297P	probably benign	Het
Tgfb1	A	G	7: 25,696,960	D226G	probably benign	Het
Ubr3	G	T	2: 70,016,244		probably null	Het
Ubr4	T	C	4: 139,468,096	Y1210H	probably damaging	Het
Ubr5	T	C	15: 38,006,541	T1157A	probably benign	Het
Vmn2r120	T	G	17: 57,524,938	T284P	probably benign	Het
Vps13b	G	T	15: 35,794,035	A2286S	probably damaging	Het
Zcchc14	A	T	8: 121,604,593		probably benign	Het
Zfr2	T	A	10: 81,243,713	V362E	probably benign	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- AACTCGAATCTCAGGAGCTG -3'
(R):5'- GTGGTAAGGTGTCAAAGTAAGTTC -3'

Sequencing Primer
(F):5'- AATCTCAGGAGCTGCCTCG -3'
(R):5'- GGAGGTGCGTGCAAATCAGC -3'

Posted On

2016-12-15