Mutagenetix > Incidental Mutation

Incidental Mutation 'R0545:Ccdc88c'

44776

Institutional Source

Beutler Lab

Gene Symbol

Ccdc88c

Ensembl Gene

ENSMUSG00000021182

Gene Name

coiled-coil domain containing 88C

Synonyms

0610010D24Rik, Daple

MMRRC Submission

038737-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100911523-101029056 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100947188 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 526 (D526G)

Ref Sequence

ENSEMBL: ENSMUSP00000068629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068411] [ENSMUST00000085096] [ENSMUST00000223235]

AlphaFold

Q6VGS5

Predicted Effect

probably damaging
Transcript: ENSMUST00000068411
AA Change: D526G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000068629
Gene: ENSMUSG00000021182
AA Change: D526G

Domain	Start	End	E-Value	Type
Pfam:HOOK	7	586	5.9e-37	PFAM
low complexity region	601	613	N/A	INTRINSIC
low complexity region	617	634	N/A	INTRINSIC
Blast:BRLZ	668	719	3e-8	BLAST
low complexity region	724	744	N/A	INTRINSIC
low complexity region	827	837	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
Blast:BRLZ	948	1007	6e-15	BLAST
coiled coil region	1035	1085	N/A	INTRINSIC
low complexity region	1095	1110	N/A	INTRINSIC
coiled coil region	1129	1252	N/A	INTRINSIC
coiled coil region	1312	1384	N/A	INTRINSIC
low complexity region	1430	1439	N/A	INTRINSIC
low complexity region	1510	1524	N/A	INTRINSIC
low complexity region	1562	1583	N/A	INTRINSIC
low complexity region	1698	1709	N/A	INTRINSIC
internal_repeat_1	1721	1778	6.97e-6	PROSPERO
low complexity region	1788	1808	N/A	INTRINSIC
internal_repeat_1	1934	1989	6.97e-6	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000085096
AA Change: D533G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000082177
Gene: ENSMUSG00000021182
AA Change: D533G

Domain	Start	End	E-Value	Type
Pfam:HOOK	13	597	2.5e-41	PFAM
low complexity region	608	620	N/A	INTRINSIC
low complexity region	624	641	N/A	INTRINSIC
Blast:BRLZ	675	726	3e-8	BLAST
low complexity region	731	751	N/A	INTRINSIC
low complexity region	834	844	N/A	INTRINSIC
low complexity region	854	873	N/A	INTRINSIC
Blast:BRLZ	955	1014	5e-15	BLAST
coiled coil region	1042	1092	N/A	INTRINSIC
low complexity region	1102	1117	N/A	INTRINSIC
coiled coil region	1136	1259	N/A	INTRINSIC
coiled coil region	1319	1391	N/A	INTRINSIC
low complexity region	1437	1446	N/A	INTRINSIC
low complexity region	1517	1531	N/A	INTRINSIC
low complexity region	1569	1590	N/A	INTRINSIC
low complexity region	1705	1716	N/A	INTRINSIC
internal_repeat_1	1728	1785	6.57e-6	PROSPERO
low complexity region	1795	1815	N/A	INTRINSIC
internal_repeat_1	1941	1996	6.57e-6	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180617

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221309

Predicted Effect

probably benign
Transcript: ENSMUST00000223235

Meta Mutation Damage Score

0.3396

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.9%
20x: 94.0%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed coiled-coil domain-containing protein that interacts with the dishevelled protein and is a negative regulator of the Wnt signalling pathway. The protein encoded by this gene has a PDZ-domain binding motif in its C-terminus with which it interacts with the dishevelled protein. Dishevelled is a scaffold protein involved in the regulation of the Wnt signaling pathway. The Wnt signaling pathway plays an important role in embryonic development, tissue maintenance, and cancer progression. Mutations in this gene cause autosomal recessive, primary non-syndromic congenital hydrocephalus; a condition characterized by excessive accumulation of cerebrospinal fluid in the ventricles of the brain. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	C	T	2: 19,542,376	R76H	probably damaging	Het
4932438A13Rik	G	A	3: 36,987,690		probably benign	Het
Adnp2	T	C	18: 80,129,401	I598V	probably benign	Het
Ago3	T	C	4: 126,417,232	N63D	probably damaging	Het
Alkbh7	C	T	17: 56,999,012	R138*	probably null	Het
Atp6ap1l	T	C	13: 90,883,663	H300R	probably benign	Het
BC051076	C	T	5: 87,963,490		noncoding transcript	Het
Bpifb9a	T	A	2: 154,261,950	C104*	probably null	Het
Cacna2d2	T	C	9: 107,525,223	L826P	probably damaging	Het
Car5b	G	A	X: 163,979,301	R282C	probably damaging	Het
Cdh23	T	A	10: 60,331,291	T1861S	probably benign	Het
Ces2f	A	C	8: 104,950,036	M121L	possibly damaging	Het
Cfap58	G	A	19: 47,941,097		probably benign	Het
Chpf2	T	C	5: 24,590,324	S282P	possibly damaging	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Cma2	A	T	14: 55,973,113	M86L	probably benign	Het
Cog6	A	T	3: 52,996,075	M134K	probably damaging	Het
Col1a1	A	G	11: 94,951,594	D1446G	unknown	Het
Cpne8	T	A	15: 90,497,075	D512V	probably damaging	Het
Ctnna2	T	A	6: 77,605,182	N352I	probably damaging	Het
Cyp2c69	A	C	19: 39,886,661	L16R	probably damaging	Het
Dysf	T	C	6: 84,099,461	S603P	probably damaging	Het
Epha5	A	G	5: 84,067,358		probably null	Het
Ercc3	T	C	18: 32,245,902	S270P	probably damaging	Het
F10	T	A	8: 13,048,249	C151S	probably damaging	Het
Gpr180	T	G	14: 118,160,046	H317Q	possibly damaging	Het
Gstp2	T	C	19: 4,041,633	E32G	possibly damaging	Het
Ikzf5	T	C	7: 131,392,500	T133A	possibly damaging	Het
Itch	G	T	2: 155,182,298	G274*	probably null	Het
Jarid2	T	A	13: 44,902,831	N365K	probably benign	Het
Lama3	T	A	18: 12,561,701	S1295T	possibly damaging	Het
Lipc	A	G	9: 70,812,705	L255P	probably damaging	Het
Lrrc38	A	G	4: 143,350,758	D197G	probably benign	Het
Mfap2	A	G	4: 141,014,185		probably benign	Het
Mfhas1	A	G	8: 35,589,048	K226E	probably damaging	Het
Morc1	A	G	16: 48,565,657	R548G	probably benign	Het
Mrgprb5	T	C	7: 48,168,885	N34S	probably benign	Het
Mroh4	T	C	15: 74,625,427	T182A	probably benign	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Myo5a	T	C	9: 75,167,037	F743L	possibly damaging	Het
Notch4	A	C	17: 34,583,433	D1276A	probably damaging	Het
Olfr139	A	G	11: 74,045,047	C76R	possibly damaging	Het
Olfr215	T	A	6: 116,582,656	I97L	probably benign	Het
Olfr394	A	T	11: 73,888,017	Y118*	probably null	Het
Olfr799	T	A	10: 129,647,349	C74S	probably damaging	Het
Plin4	T	A	17: 56,106,567	T353S	probably damaging	Het
Ppp1r9a	A	G	6: 5,115,357	T827A	probably benign	Het
Prlr	C	T	15: 10,317,566	T40I	probably damaging	Het
Psme3	T	C	11: 101,319,904		probably benign	Het
Pygb	A	T	2: 150,815,706	D363V	probably benign	Het
Rsph6a	C	T	7: 19,054,946	Q68*	probably null	Het
Serpini2	A	G	3: 75,258,138	V178A	probably benign	Het
Sh2d2a	T	C	3: 87,851,888		probably benign	Het
Skint7	A	C	4: 111,980,198	M58L	probably benign	Het
Slco3a1	G	T	7: 74,320,553	Y435*	probably null	Het
Stk17b	T	C	1: 53,762,583		probably benign	Het
Tinag	T	A	9: 77,031,710	H162L	possibly damaging	Het
Ttc21a	T	A	9: 119,958,799	L811Q	probably damaging	Het
Ttc41	A	T	10: 86,759,097	M912L	probably benign	Het
Vmn2r98	G	T	17: 19,053,613	V41F	probably benign	Het
Washc5	C	T	15: 59,342,093	C838Y	possibly damaging	Het
Wrnip1	A	G	13: 32,806,813	T352A	probably damaging	Het
Zan	A	C	5: 137,396,177	C4467G	unknown	Het
Zc3h7a	T	C	16: 11,152,333		probably benign	Het
Zfp729a	C	A	13: 67,620,226	C628F	probably benign	Het

Other mutations in Ccdc88c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01112:Ccdc88c	APN	12	100916803	missense	probably benign	0.04
IGL02016:Ccdc88c	APN	12	100941207	missense	possibly damaging	0.63
IGL02031:Ccdc88c	APN	12	100933311	missense	probably damaging	0.98
IGL02133:Ccdc88c	APN	12	100940090	missense	probably damaging	1.00
IGL02427:Ccdc88c	APN	12	100921592	missense	probably damaging	1.00
IGL02494:Ccdc88c	APN	12	100945475	missense	probably benign
IGL02496:Ccdc88c	APN	12	100953293	missense	probably benign	0.05
IGL02549:Ccdc88c	APN	12	100928932	missense	probably benign	0.18
IGL02618:Ccdc88c	APN	12	100913553	missense	probably benign	0.28
IGL02626:Ccdc88c	APN	12	100967800	unclassified	probably benign
IGL03142:Ccdc88c	APN	12	100947198	missense	probably damaging	1.00
BB010:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
BB020:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
R0127:Ccdc88c	UTSW	12	100935740	missense	possibly damaging	0.88
R0533:Ccdc88c	UTSW	12	100954282	missense	probably damaging	1.00
R0866:Ccdc88c	UTSW	12	100913192	missense	probably benign	0.01
R1230:Ccdc88c	UTSW	12	100948488	missense	probably benign	0.00
R1434:Ccdc88c	UTSW	12	100939166	splice site	probably benign
R1614:Ccdc88c	UTSW	12	100912984	missense	probably benign	0.00
R1644:Ccdc88c	UTSW	12	100913474	missense	probably damaging	0.98
R1712:Ccdc88c	UTSW	12	100939025	missense	probably benign	0.14
R2107:Ccdc88c	UTSW	12	100921549	missense	probably benign
R3612:Ccdc88c	UTSW	12	100939073	missense	probably damaging	0.99
R3724:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R3737:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R3743:Ccdc88c	UTSW	12	100948584	missense	probably damaging	1.00
R3772:Ccdc88c	UTSW	12	100966100	unclassified	probably benign
R3776:Ccdc88c	UTSW	12	100947179	missense	probably damaging	0.97
R3917:Ccdc88c	UTSW	12	100941107	critical splice donor site	probably null
R4034:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R4035:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R4110:Ccdc88c	UTSW	12	100945073	missense	probably damaging	1.00
R4113:Ccdc88c	UTSW	12	100945073	missense	probably damaging	1.00
R4270:Ccdc88c	UTSW	12	100947219	missense	probably damaging	1.00
R4271:Ccdc88c	UTSW	12	100947219	missense	probably damaging	1.00
R4520:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4521:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4522:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4523:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4524:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4717:Ccdc88c	UTSW	12	100916666	missense	probably benign	0.00
R4821:Ccdc88c	UTSW	12	100938079	missense	probably benign	0.00
R4823:Ccdc88c	UTSW	12	100930543	missense	probably damaging	1.00
R5090:Ccdc88c	UTSW	12	100954180	missense	probably damaging	1.00
R5510:Ccdc88c	UTSW	12	100945031	missense	probably damaging	1.00
R5514:Ccdc88c	UTSW	12	100913439	missense	probably damaging	1.00
R5903:Ccdc88c	UTSW	12	100930542	missense	probably damaging	1.00
R5999:Ccdc88c	UTSW	12	100968354	missense	probably damaging	1.00
R6131:Ccdc88c	UTSW	12	100941128	missense	probably damaging	1.00
R6164:Ccdc88c	UTSW	12	100953383	missense	probably damaging	0.98
R6971:Ccdc88c	UTSW	12	100954227	missense	probably damaging	1.00
R6998:Ccdc88c	UTSW	12	100916852	missense	probably damaging	0.96
R7031:Ccdc88c	UTSW	12	100945064	missense	probably damaging	1.00
R7240:Ccdc88c	UTSW	12	100944939	missense	probably benign	0.17
R7366:Ccdc88c	UTSW	12	100944950	missense	possibly damaging	0.89
R7604:Ccdc88c	UTSW	12	100930547	missense	probably damaging	1.00
R7674:Ccdc88c	UTSW	12	100945232	missense	probably benign	0.00
R7795:Ccdc88c	UTSW	12	100923311	missense	probably benign	0.32
R7933:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
R7990:Ccdc88c	UTSW	12	100967985	missense	probably damaging	1.00
R8339:Ccdc88c	UTSW	12	100941140	nonsense	probably null
R8734:Ccdc88c	UTSW	12	100940135	missense	probably damaging	1.00
R8778:Ccdc88c	UTSW	12	100945224	missense	probably benign	0.25
R8925:Ccdc88c	UTSW	12	100966417	missense	possibly damaging	0.55
R8927:Ccdc88c	UTSW	12	100966417	missense	possibly damaging	0.55
R9014:Ccdc88c	UTSW	12	100913064	missense	probably benign	0.09
R9204:Ccdc88c	UTSW	12	100938063	missense	unknown
R9257:Ccdc88c	UTSW	12	100923215	missense	possibly damaging	0.94
R9326:Ccdc88c	UTSW	12	101028850	start gained	probably benign
R9424:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
R9439:Ccdc88c	UTSW	12	100918338	missense	probably benign	0.25
R9539:Ccdc88c	UTSW	12	100935734	missense	possibly damaging	0.89
R9576:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
Z1176:Ccdc88c	UTSW	12	100945770	missense	possibly damaging	0.69
Z1177:Ccdc88c	UTSW	12	100945155	missense	probably benign
Z1190:Ccdc88c	UTSW	12	100923332	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACAATCAGAGCTGTCTGGGGACAC -3'
(R):5'- GGGACTGAGGGAATACATTGCTGC -3'

Sequencing Primer
(F):5'- TCTGGGGACACTACCCAGC -3'
(R):5'- GAGAGACACTGGTACATTTTTTGTCC -3'

Posted On

2013-06-11