Incidental Mutation 'R5782:Klf7'
ID447764
Institutional Source Beutler Lab
Gene Symbol Klf7
Ensembl Gene ENSMUSG00000025959
Gene NameKruppel-like factor 7 (ubiquitous)
Synonyms9830124P08Rik
MMRRC Submission 043379-MU
Accession Numbers

Genbank: NM_033563; MGI: 1935151

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5782 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location64029447-64122282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64042411 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 253 (E253K)
Ref Sequence ENSEMBL: ENSMUSP00000109720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055001] [ENSMUST00000114086]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055001
AA Change: E253K

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054674
Gene: ENSMUSG00000025959
AA Change: E253K

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 162 194 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
ZnF_C2H2 218 242 3.83e-2 SMART
ZnF_C2H2 248 272 4.94e-5 SMART
ZnF_C2H2 278 300 6.78e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114086
AA Change: E253K

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109720
Gene: ENSMUSG00000025959
AA Change: E253K

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 162 194 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
ZnF_C2H2 218 242 3.83e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184798
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kruppel-like transcriptional regulator family. Members in this family regulate cell proliferation, differentiation and survival and contain three C2H2 zinc fingers at the C-terminus that mediate binding to GC-rich sites. This protein may contribute to the progression of type 2 diabetes by inhibiting insulin expression and secretion in pancreatic beta-cells and by deregulating adipocytokine secretion in adipocytes. A pseudogene of this gene is located on the long arm of chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null mice die within 3 days of life, showing lack of gastic milk, hypopnea, cyanosis, olfactory bulb hypoplasia, no response to tail clamping, impaired axon projection in the olfactory and visual systems, cerebral cortex and hippocampus, and reduced dendritic branching in the hippocampus. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,903 I81M probably benign Het
2810403A07Rik T G 3: 88,711,678 V563G probably damaging Het
9130011E15Rik A G 19: 45,886,027 V569A probably benign Het
Actl9 A T 17: 33,433,761 Q265L probably benign Het
Adamtsl3 T A 7: 82,540,286 probably null Het
Agt A T 8: 124,557,131 probably null Het
Ankrd11 A G 8: 122,900,017 L142P probably damaging Het
Arhgef19 C A 4: 141,256,312 Q719K probably damaging Het
Atrnl1 G T 19: 57,753,286 W1159L possibly damaging Het
Atxn2 T C 5: 121,797,310 Y325H probably damaging Het
Brwd1 A T 16: 96,043,043 Y770* probably null Het
Cdc20 T C 4: 118,433,042 E474G probably benign Het
Cdk5rap3 A G 11: 96,911,586 L254P probably benign Het
Cep83 A T 10: 94,749,032 N333I probably damaging Het
Cox4i2 A C 2: 152,764,811 D150A probably damaging Het
Cse1l A G 2: 166,929,001 I314M probably damaging Het
Cuedc1 A G 11: 88,170,032 Y67C probably damaging Het
Cyp2j9 C T 4: 96,573,905 V380I probably benign Het
D3Ertd254e T C 3: 36,164,979 S384P possibly damaging Het
Fancd2 A G 6: 113,548,872 N302S probably benign Het
Foxa1 T A 12: 57,542,516 H306L probably benign Het
Gm21994 T C 2: 150,255,518 E25G probably benign Het
Gse1 T C 8: 120,566,521 S204P probably damaging Het
Hspa13 C A 16: 75,758,097 R367L probably damaging Het
Kcnk2 T G 1: 189,256,579 D267A probably damaging Het
Kctd18 A G 1: 57,959,237 Y68H probably damaging Het
Lcn12 A T 2: 25,493,757 F34I probably damaging Het
Lrrk2 A T 15: 91,702,183 R401W probably damaging Het
Lzts1 A T 8: 69,140,698 S86T probably benign Het
Mtus1 T A 8: 41,082,727 I651F probably damaging Het
Myl2 T A 5: 122,104,870 F106L probably damaging Het
Neb T A 2: 52,264,047 K2351* probably null Het
Olfr297 T A 7: 86,527,213 I152N probably damaging Het
Olfr678 T C 7: 105,069,749 I94T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Parg A T 14: 32,274,905 R318* probably null Het
Pcdhga3 C T 18: 37,676,300 S602F possibly damaging Het
Pcnx2 A G 8: 125,753,484 V2028A probably damaging Het
Pkhd1 T C 1: 20,058,600 T3960A probably benign Het
Psen1 T A 12: 83,712,459 H81Q possibly damaging Het
Psma6 A G 12: 55,410,256 N109S possibly damaging Het
Ptpro A T 6: 137,399,498 I659F possibly damaging Het
Rap1gds1 C G 3: 138,959,079 E288D possibly damaging Het
Reln C T 5: 22,018,056 R993K probably benign Het
Saxo1 T A 4: 86,445,807 L146F probably damaging Het
Six4 A G 12: 73,104,058 V571A probably benign Het
Slc2a10 C A 2: 165,514,838 Y139* probably null Het
Slc34a1 A G 13: 55,402,688 I66V possibly damaging Het
Slfn8 G T 11: 83,017,041 N46K probably damaging Het
Smc6 G C 12: 11,290,834 A496P probably damaging Het
Stk31 T G 6: 49,469,136 N902K probably benign Het
Stk36 T A 1: 74,605,425 Y114N possibly damaging Het
Sult2b1 C T 7: 45,731,346 V271M probably damaging Het
Tenm4 A G 7: 96,893,039 I1920V probably benign Het
Trbc2 A G 6: 41,546,937 probably benign Het
Trpc2 A G 7: 102,083,979 D419G possibly damaging Het
Trpm7 T C 2: 126,797,714 N1654S probably benign Het
Tsku A T 7: 98,352,850 D91E probably damaging Het
Ttn T A 2: 76,776,011 R18151S probably damaging Het
Tyr C T 7: 87,493,016 C112Y probably damaging Het
Ubash3a G A 17: 31,235,503 G435S probably benign Het
Vav1 T C 17: 57,296,001 I51T probably damaging Het
Vmn2r61 T A 7: 42,299,829 C558S probably damaging Het
Zan C T 5: 137,420,007 C2943Y unknown Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp575 C A 7: 24,585,602 G205C possibly damaging Het
Zfp740 G T 15: 102,208,366 probably benign Het
Zzz3 A G 3: 152,428,100 E265G possibly damaging Het
Other mutations in Klf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Klf7 APN 1 64042317 missense possibly damaging 0.65
IGL01684:Klf7 APN 1 64120892 splice site probably benign
IGL01844:Klf7 APN 1 64078774 missense probably benign 0.02
IGL03181:Klf7 APN 1 64035726 missense possibly damaging 0.88
Esurientes UTSW 1 64079213 missense possibly damaging 0.78
C9142:Klf7 UTSW 1 64079157 missense possibly damaging 0.47
R1736:Klf7 UTSW 1 64079213 missense possibly damaging 0.78
R1737:Klf7 UTSW 1 64079213 missense possibly damaging 0.78
R1744:Klf7 UTSW 1 64079213 missense possibly damaging 0.78
R2048:Klf7 UTSW 1 64078754 missense possibly damaging 0.65
R2891:Klf7 UTSW 1 64042362 missense probably damaging 1.00
R5055:Klf7 UTSW 1 64079280 missense probably benign 0.08
R5613:Klf7 UTSW 1 64042396 missense probably damaging 0.98
R7369:Klf7 UTSW 1 64121141 critical splice acceptor site probably null
R7470:Klf7 UTSW 1 64042313 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCCTGCTTGCTACTAGAC -3'
(R):5'- ATGGCTCAGAGGTTTGAAGG -3'

Sequencing Primer
(F):5'- GCTTGCTACTAGACCCAGATC -3'
(R):5'- ACACACAGCACCAGGGGG -3'
Posted On2016-12-15