Incidental Mutation 'R5782:Cse1l'
ID 447777
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1-like (S. cerevisiae)
Synonyms Capts, Xpo2, 2610100P18Rik, Cas
MMRRC Submission 043379-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5782 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 166906040-166946389 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 166929001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 314 (I314M)
Ref Sequence ENSEMBL: ENSMUSP00000129983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably damaging
Transcript: ENSMUST00000002790
AA Change: I370M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: I370M

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135139
Predicted Effect probably damaging
Transcript: ENSMUST00000163437
AA Change: I85M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: I85M

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166871
Predicted Effect probably damaging
Transcript: ENSMUST00000168599
AA Change: I314M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: I314M

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169290
AA Change: I370M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718
AA Change: I370M

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171410
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,903 I81M probably benign Het
2810403A07Rik T G 3: 88,711,678 V563G probably damaging Het
9130011E15Rik A G 19: 45,886,027 V569A probably benign Het
Actl9 A T 17: 33,433,761 Q265L probably benign Het
Adamtsl3 T A 7: 82,540,286 probably null Het
Agt A T 8: 124,557,131 probably null Het
Ankrd11 A G 8: 122,900,017 L142P probably damaging Het
Arhgef19 C A 4: 141,256,312 Q719K probably damaging Het
Atrnl1 G T 19: 57,753,286 W1159L possibly damaging Het
Atxn2 T C 5: 121,797,310 Y325H probably damaging Het
Brwd1 A T 16: 96,043,043 Y770* probably null Het
Cdc20 T C 4: 118,433,042 E474G probably benign Het
Cdk5rap3 A G 11: 96,911,586 L254P probably benign Het
Cep83 A T 10: 94,749,032 N333I probably damaging Het
Cox4i2 A C 2: 152,764,811 D150A probably damaging Het
Cuedc1 A G 11: 88,170,032 Y67C probably damaging Het
Cyp2j9 C T 4: 96,573,905 V380I probably benign Het
D3Ertd254e T C 3: 36,164,979 S384P possibly damaging Het
Fancd2 A G 6: 113,548,872 N302S probably benign Het
Foxa1 T A 12: 57,542,516 H306L probably benign Het
Gm21994 T C 2: 150,255,518 E25G probably benign Het
Gse1 T C 8: 120,566,521 S204P probably damaging Het
Hspa13 C A 16: 75,758,097 R367L probably damaging Het
Kcnk2 T G 1: 189,256,579 D267A probably damaging Het
Kctd18 A G 1: 57,959,237 Y68H probably damaging Het
Klf7 C T 1: 64,042,411 E253K possibly damaging Het
Lcn12 A T 2: 25,493,757 F34I probably damaging Het
Lrrk2 A T 15: 91,702,183 R401W probably damaging Het
Lzts1 A T 8: 69,140,698 S86T probably benign Het
Mtus1 T A 8: 41,082,727 I651F probably damaging Het
Myl2 T A 5: 122,104,870 F106L probably damaging Het
Neb T A 2: 52,264,047 K2351* probably null Het
Olfr297 T A 7: 86,527,213 I152N probably damaging Het
Olfr678 T C 7: 105,069,749 I94T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Parg A T 14: 32,274,905 R318* probably null Het
Pcdhga3 C T 18: 37,676,300 S602F possibly damaging Het
Pcnx2 A G 8: 125,753,484 V2028A probably damaging Het
Pkhd1 T C 1: 20,058,600 T3960A probably benign Het
Psen1 T A 12: 83,712,459 H81Q possibly damaging Het
Psma6 A G 12: 55,410,256 N109S possibly damaging Het
Ptpro A T 6: 137,399,498 I659F possibly damaging Het
Rap1gds1 C G 3: 138,959,079 E288D possibly damaging Het
Reln C T 5: 22,018,056 R993K probably benign Het
Saxo1 T A 4: 86,445,807 L146F probably damaging Het
Six4 A G 12: 73,104,058 V571A probably benign Het
Slc2a10 C A 2: 165,514,838 Y139* probably null Het
Slc34a1 A G 13: 55,402,688 I66V possibly damaging Het
Slfn8 G T 11: 83,017,041 N46K probably damaging Het
Smc6 G C 12: 11,290,834 A496P probably damaging Het
Stk31 T G 6: 49,469,136 N902K probably benign Het
Stk36 T A 1: 74,605,425 Y114N possibly damaging Het
Sult2b1 C T 7: 45,731,346 V271M probably damaging Het
Tenm4 A G 7: 96,893,039 I1920V probably benign Het
Trbc2 A G 6: 41,546,937 probably benign Het
Trpc2 A G 7: 102,083,979 D419G possibly damaging Het
Trpm7 T C 2: 126,797,714 N1654S probably benign Het
Tsku A T 7: 98,352,850 D91E probably damaging Het
Ttn T A 2: 76,776,011 R18151S probably damaging Het
Tyr C T 7: 87,493,016 C112Y probably damaging Het
Ubash3a G A 17: 31,235,503 G435S probably benign Het
Vav1 T C 17: 57,296,001 I51T probably damaging Het
Vmn2r61 T A 7: 42,299,829 C558S probably damaging Het
Zan C T 5: 137,420,007 C2943Y unknown Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp575 C A 7: 24,585,602 G205C possibly damaging Het
Zfp740 G T 15: 102,208,366 probably benign Het
Zzz3 A G 3: 152,428,100 E265G possibly damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166927804 missense probably damaging 1.00
IGL01306:Cse1l APN 2 166927508 nonsense probably null
IGL01672:Cse1l APN 2 166929967 missense probably damaging 1.00
IGL02060:Cse1l APN 2 166930653 missense probably damaging 1.00
IGL02897:Cse1l APN 2 166919708 missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166943057 splice site probably benign
ANU23:Cse1l UTSW 2 166927508 nonsense probably null
PIT4585001:Cse1l UTSW 2 166941474 missense probably damaging 1.00
R0195:Cse1l UTSW 2 166940088 missense probably benign
R1114:Cse1l UTSW 2 166941203 splice site probably benign
R1539:Cse1l UTSW 2 166926372 missense probably benign 0.00
R1721:Cse1l UTSW 2 166926411 missense probably damaging 1.00
R1779:Cse1l UTSW 2 166940124 splice site probably null
R1913:Cse1l UTSW 2 166922191 missense probably damaging 1.00
R2069:Cse1l UTSW 2 166941492 missense probably benign 0.01
R2398:Cse1l UTSW 2 166928997 missense probably damaging 1.00
R4110:Cse1l UTSW 2 166942050 missense probably benign 0.00
R4195:Cse1l UTSW 2 166929979 missense probably damaging 1.00
R4603:Cse1l UTSW 2 166944532 missense probably benign 0.09
R4686:Cse1l UTSW 2 166932160 missense probably damaging 1.00
R4867:Cse1l UTSW 2 166926403 missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166929794 missense probably damaging 1.00
R5164:Cse1l UTSW 2 166944428 missense probably benign 0.02
R5475:Cse1l UTSW 2 166941254 missense probably damaging 1.00
R5493:Cse1l UTSW 2 166941190 intron probably benign
R5862:Cse1l UTSW 2 166915207 missense probably benign 0.00
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6913:Cse1l UTSW 2 166929877 missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166922788 missense probably benign
R7871:Cse1l UTSW 2 166935671 splice site probably null
R8001:Cse1l UTSW 2 166939913 missense probably damaging 1.00
R8057:Cse1l UTSW 2 166939925 missense probably damaging 1.00
R8175:Cse1l UTSW 2 166943208 critical splice donor site probably null
R8347:Cse1l UTSW 2 166927585 missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166919684 missense probably benign 0.00
R8479:Cse1l UTSW 2 166921973 missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166943080 missense probably damaging 1.00
R9206:Cse1l UTSW 2 166941265 missense probably damaging 1.00
R9208:Cse1l UTSW 2 166941265 missense probably damaging 1.00
R9522:Cse1l UTSW 2 166934753 missense probably benign
R9599:Cse1l UTSW 2 166941466 missense probably benign
R9600:Cse1l UTSW 2 166915199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGCTGCAGTCACAGTG -3'
(R):5'- GGCCAGAAGTCAATGTGAGC -3'

Sequencing Primer
(F):5'- CTGCTGCAGTCACAGTGAAAGAC -3'
(R):5'- GCCAGAAGTCAATGTGAGCATCTTC -3'
Posted On 2016-12-15