Mutagenetix > Incidental Mutation

Incidental Mutation 'R5782:Cse1l'

447777

Institutional Source

Beutler Lab

Gene Symbol

Cse1l

Ensembl Gene

ENSMUSG00000002718

Gene Name

chromosome segregation 1-like (S. cerevisiae)

Synonyms

Capts, Xpo2, 2610100P18Rik, Cas

MMRRC Submission

043379-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5782 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

166906040-166946389 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 166929001 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 314 (I314M)

Ref Sequence

ENSEMBL: ENSMUSP00000129983 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]

AlphaFold

Q9ERK4

Predicted Effect

probably damaging
Transcript: ENSMUST00000002790
AA Change: I370M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: I370M

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	526	9.2e-169	PFAM
Pfam:CAS_CSE1	527	962	1.1e-181	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132402

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135139

Predicted Effect

probably damaging
Transcript: ENSMUST00000163437
AA Change: I85M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: I85M

Domain	Start	End	E-Value	Type
Pfam:Cse1	1	237	7.9e-105	PFAM
Pfam:CAS_CSE1	225	649	2.3e-195	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166871

Predicted Effect

probably damaging
Transcript: ENSMUST00000168599
AA Change: I314M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: I314M

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	256	8.6e-40	PFAM
Pfam:Cse1	255	470	7.3e-99	PFAM
Pfam:CAS_CSE1	471	906	1.3e-201	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000169290
AA Change: I370M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718
AA Change: I370M

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	389	5.2e-102	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171410

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	T	C	10: 43,532,903	I81M	probably benign	Het
2810403A07Rik	T	G	3: 88,711,678	V563G	probably damaging	Het
9130011E15Rik	A	G	19: 45,886,027	V569A	probably benign	Het
Actl9	A	T	17: 33,433,761	Q265L	probably benign	Het
Adamtsl3	T	A	7: 82,540,286		probably null	Het
Agt	A	T	8: 124,557,131		probably null	Het
Ankrd11	A	G	8: 122,900,017	L142P	probably damaging	Het
Arhgef19	C	A	4: 141,256,312	Q719K	probably damaging	Het
Atrnl1	G	T	19: 57,753,286	W1159L	possibly damaging	Het
Atxn2	T	C	5: 121,797,310	Y325H	probably damaging	Het
Brwd1	A	T	16: 96,043,043	Y770*	probably null	Het
Cdc20	T	C	4: 118,433,042	E474G	probably benign	Het
Cdk5rap3	A	G	11: 96,911,586	L254P	probably benign	Het
Cep83	A	T	10: 94,749,032	N333I	probably damaging	Het
Cox4i2	A	C	2: 152,764,811	D150A	probably damaging	Het
Cuedc1	A	G	11: 88,170,032	Y67C	probably damaging	Het
Cyp2j9	C	T	4: 96,573,905	V380I	probably benign	Het
D3Ertd254e	T	C	3: 36,164,979	S384P	possibly damaging	Het
Fancd2	A	G	6: 113,548,872	N302S	probably benign	Het
Foxa1	T	A	12: 57,542,516	H306L	probably benign	Het
Gm21994	T	C	2: 150,255,518	E25G	probably benign	Het
Gse1	T	C	8: 120,566,521	S204P	probably damaging	Het
Hspa13	C	A	16: 75,758,097	R367L	probably damaging	Het
Kcnk2	T	G	1: 189,256,579	D267A	probably damaging	Het
Kctd18	A	G	1: 57,959,237	Y68H	probably damaging	Het
Klf7	C	T	1: 64,042,411	E253K	possibly damaging	Het
Lcn12	A	T	2: 25,493,757	F34I	probably damaging	Het
Lrrk2	A	T	15: 91,702,183	R401W	probably damaging	Het
Lzts1	A	T	8: 69,140,698	S86T	probably benign	Het
Mtus1	T	A	8: 41,082,727	I651F	probably damaging	Het
Myl2	T	A	5: 122,104,870	F106L	probably damaging	Het
Neb	T	A	2: 52,264,047	K2351*	probably null	Het
Olfr297	T	A	7: 86,527,213	I152N	probably damaging	Het
Olfr678	T	C	7: 105,069,749	I94T	probably damaging	Het
Otogl	G	A	10: 107,777,117		silent	Het
Parg	A	T	14: 32,274,905	R318*	probably null	Het
Pcdhga3	C	T	18: 37,676,300	S602F	possibly damaging	Het
Pcnx2	A	G	8: 125,753,484	V2028A	probably damaging	Het
Pkhd1	T	C	1: 20,058,600	T3960A	probably benign	Het
Psen1	T	A	12: 83,712,459	H81Q	possibly damaging	Het
Psma6	A	G	12: 55,410,256	N109S	possibly damaging	Het
Ptpro	A	T	6: 137,399,498	I659F	possibly damaging	Het
Rap1gds1	C	G	3: 138,959,079	E288D	possibly damaging	Het
Reln	C	T	5: 22,018,056	R993K	probably benign	Het
Saxo1	T	A	4: 86,445,807	L146F	probably damaging	Het
Six4	A	G	12: 73,104,058	V571A	probably benign	Het
Slc2a10	C	A	2: 165,514,838	Y139*	probably null	Het
Slc34a1	A	G	13: 55,402,688	I66V	possibly damaging	Het
Slfn8	G	T	11: 83,017,041	N46K	probably damaging	Het
Smc6	G	C	12: 11,290,834	A496P	probably damaging	Het
Stk31	T	G	6: 49,469,136	N902K	probably benign	Het
Stk36	T	A	1: 74,605,425	Y114N	possibly damaging	Het
Sult2b1	C	T	7: 45,731,346	V271M	probably damaging	Het
Tenm4	A	G	7: 96,893,039	I1920V	probably benign	Het
Trbc2	A	G	6: 41,546,937		probably benign	Het
Trpc2	A	G	7: 102,083,979	D419G	possibly damaging	Het
Trpm7	T	C	2: 126,797,714	N1654S	probably benign	Het
Tsku	A	T	7: 98,352,850	D91E	probably damaging	Het
Ttn	T	A	2: 76,776,011	R18151S	probably damaging	Het
Tyr	C	T	7: 87,493,016	C112Y	probably damaging	Het
Ubash3a	G	A	17: 31,235,503	G435S	probably benign	Het
Vav1	T	C	17: 57,296,001	I51T	probably damaging	Het
Vmn2r61	T	A	7: 42,299,829	C558S	probably damaging	Het
Zan	C	T	5: 137,420,007	C2943Y	unknown	Het
Zfp318	TGAAGAAGAAGAAGAAGAAGAAGAAGAAG	TGAAGAAGAAGAAGAAGAAGAAG	17: 46,412,514		probably benign	Het
Zfp575	C	A	7: 24,585,602	G205C	possibly damaging	Het
Zfp740	G	T	15: 102,208,366		probably benign	Het
Zzz3	A	G	3: 152,428,100	E265G	possibly damaging	Het

Other mutations in Cse1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Cse1l	APN	2	166927804	missense	probably damaging	1.00
IGL01306:Cse1l	APN	2	166927508	nonsense	probably null
IGL01672:Cse1l	APN	2	166929967	missense	probably damaging	1.00
IGL02060:Cse1l	APN	2	166930653	missense	probably damaging	1.00
IGL02897:Cse1l	APN	2	166919708	missense	possibly damaging	0.47
IGL03375:Cse1l	APN	2	166943057	splice site	probably benign
ANU23:Cse1l	UTSW	2	166927508	nonsense	probably null
PIT4585001:Cse1l	UTSW	2	166941474	missense	probably damaging	1.00
R0195:Cse1l	UTSW	2	166940088	missense	probably benign
R1114:Cse1l	UTSW	2	166941203	splice site	probably benign
R1539:Cse1l	UTSW	2	166926372	missense	probably benign	0.00
R1721:Cse1l	UTSW	2	166926411	missense	probably damaging	1.00
R1779:Cse1l	UTSW	2	166940124	splice site	probably null
R1913:Cse1l	UTSW	2	166922191	missense	probably damaging	1.00
R2069:Cse1l	UTSW	2	166941492	missense	probably benign	0.01
R2398:Cse1l	UTSW	2	166928997	missense	probably damaging	1.00
R4110:Cse1l	UTSW	2	166942050	missense	probably benign	0.00
R4195:Cse1l	UTSW	2	166929979	missense	probably damaging	1.00
R4603:Cse1l	UTSW	2	166944532	missense	probably benign	0.09
R4686:Cse1l	UTSW	2	166932160	missense	probably damaging	1.00
R4867:Cse1l	UTSW	2	166926403	missense	possibly damaging	0.76
R4942:Cse1l	UTSW	2	166929794	missense	probably damaging	1.00
R5164:Cse1l	UTSW	2	166944428	missense	probably benign	0.02
R5475:Cse1l	UTSW	2	166941254	missense	probably damaging	1.00
R5493:Cse1l	UTSW	2	166941190	intron	probably benign
R5862:Cse1l	UTSW	2	166915207	missense	probably benign	0.00
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6913:Cse1l	UTSW	2	166929877	missense	possibly damaging	0.65
R7683:Cse1l	UTSW	2	166922788	missense	probably benign
R7871:Cse1l	UTSW	2	166935671	splice site	probably null
R8001:Cse1l	UTSW	2	166939913	missense	probably damaging	1.00
R8057:Cse1l	UTSW	2	166939925	missense	probably damaging	1.00
R8175:Cse1l	UTSW	2	166943208	critical splice donor site	probably null
R8347:Cse1l	UTSW	2	166927585	missense	possibly damaging	0.95
R8386:Cse1l	UTSW	2	166919684	missense	probably benign	0.00
R8479:Cse1l	UTSW	2	166921973	missense	possibly damaging	0.95
R8973:Cse1l	UTSW	2	166943080	missense	probably damaging	1.00
R9206:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9208:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9522:Cse1l	UTSW	2	166934753	missense	probably benign
R9599:Cse1l	UTSW	2	166941466	missense	probably benign
R9600:Cse1l	UTSW	2	166915199	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTGCTGCAGTCACAGTG -3'
(R):5'- GGCCAGAAGTCAATGTGAGC -3'

Sequencing Primer
(F):5'- CTGCTGCAGTCACAGTGAAAGAC -3'
(R):5'- GCCAGAAGTCAATGTGAGCATCTTC -3'

Posted On

2016-12-15