Incidental Mutation 'R5782:Saxo1'
ID447782
Institutional Source Beutler Lab
Gene Symbol Saxo1
Ensembl Gene ENSMUSG00000028492
Gene Namestabilizer of axonemal microtubules 1
Synonyms4930500O09Rik, Fam154a
MMRRC Submission 043379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5782 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location86444641-86558328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86445807 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 146 (L146F)
Ref Sequence ENSEMBL: ENSMUSP00000030216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030216]
Predicted Effect probably damaging
Transcript: ENSMUST00000030216
AA Change: L146F

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030216
Gene: ENSMUSG00000028492
AA Change: L146F

DomainStartEndE-ValueType
Pfam:STOP 5 129 2.4e-13 PFAM
Pfam:STOP 88 265 1.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151481
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,903 I81M probably benign Het
2810403A07Rik T G 3: 88,711,678 V563G probably damaging Het
9130011E15Rik A G 19: 45,886,027 V569A probably benign Het
Actl9 A T 17: 33,433,761 Q265L probably benign Het
Adamtsl3 T A 7: 82,540,286 probably null Het
Agt A T 8: 124,557,131 probably null Het
Ankrd11 A G 8: 122,900,017 L142P probably damaging Het
Arhgef19 C A 4: 141,256,312 Q719K probably damaging Het
Atrnl1 G T 19: 57,753,286 W1159L possibly damaging Het
Atxn2 T C 5: 121,797,310 Y325H probably damaging Het
Brwd1 A T 16: 96,043,043 Y770* probably null Het
Cdc20 T C 4: 118,433,042 E474G probably benign Het
Cdk5rap3 A G 11: 96,911,586 L254P probably benign Het
Cep83 A T 10: 94,749,032 N333I probably damaging Het
Cox4i2 A C 2: 152,764,811 D150A probably damaging Het
Cse1l A G 2: 166,929,001 I314M probably damaging Het
Cuedc1 A G 11: 88,170,032 Y67C probably damaging Het
Cyp2j9 C T 4: 96,573,905 V380I probably benign Het
D3Ertd254e T C 3: 36,164,979 S384P possibly damaging Het
Fancd2 A G 6: 113,548,872 N302S probably benign Het
Foxa1 T A 12: 57,542,516 H306L probably benign Het
Gm21994 T C 2: 150,255,518 E25G probably benign Het
Gse1 T C 8: 120,566,521 S204P probably damaging Het
Hspa13 C A 16: 75,758,097 R367L probably damaging Het
Kcnk2 T G 1: 189,256,579 D267A probably damaging Het
Kctd18 A G 1: 57,959,237 Y68H probably damaging Het
Klf7 C T 1: 64,042,411 E253K possibly damaging Het
Lcn12 A T 2: 25,493,757 F34I probably damaging Het
Lrrk2 A T 15: 91,702,183 R401W probably damaging Het
Lzts1 A T 8: 69,140,698 S86T probably benign Het
Mtus1 T A 8: 41,082,727 I651F probably damaging Het
Myl2 T A 5: 122,104,870 F106L probably damaging Het
Neb T A 2: 52,264,047 K2351* probably null Het
Olfr297 T A 7: 86,527,213 I152N probably damaging Het
Olfr678 T C 7: 105,069,749 I94T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Parg A T 14: 32,274,905 R318* probably null Het
Pcdhga3 C T 18: 37,676,300 S602F possibly damaging Het
Pcnx2 A G 8: 125,753,484 V2028A probably damaging Het
Pkhd1 T C 1: 20,058,600 T3960A probably benign Het
Psen1 T A 12: 83,712,459 H81Q possibly damaging Het
Psma6 A G 12: 55,410,256 N109S possibly damaging Het
Ptpro A T 6: 137,399,498 I659F possibly damaging Het
Rap1gds1 C G 3: 138,959,079 E288D possibly damaging Het
Reln C T 5: 22,018,056 R993K probably benign Het
Six4 A G 12: 73,104,058 V571A probably benign Het
Slc2a10 C A 2: 165,514,838 Y139* probably null Het
Slc34a1 A G 13: 55,402,688 I66V possibly damaging Het
Slfn8 G T 11: 83,017,041 N46K probably damaging Het
Smc6 G C 12: 11,290,834 A496P probably damaging Het
Stk31 T G 6: 49,469,136 N902K probably benign Het
Stk36 T A 1: 74,605,425 Y114N possibly damaging Het
Sult2b1 C T 7: 45,731,346 V271M probably damaging Het
Tenm4 A G 7: 96,893,039 I1920V probably benign Het
Trbc2 A G 6: 41,546,937 probably benign Het
Trpc2 A G 7: 102,083,979 D419G possibly damaging Het
Trpm7 T C 2: 126,797,714 N1654S probably benign Het
Tsku A T 7: 98,352,850 D91E probably damaging Het
Ttn T A 2: 76,776,011 R18151S probably damaging Het
Tyr C T 7: 87,493,016 C112Y probably damaging Het
Ubash3a G A 17: 31,235,503 G435S probably benign Het
Vav1 T C 17: 57,296,001 I51T probably damaging Het
Vmn2r61 T A 7: 42,299,829 C558S probably damaging Het
Zan C T 5: 137,420,007 C2943Y unknown Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp575 C A 7: 24,585,602 G205C possibly damaging Het
Zfp740 G T 15: 102,208,366 probably benign Het
Zzz3 A G 3: 152,428,100 E265G possibly damaging Het
Other mutations in Saxo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Saxo1 APN 4 86445572 missense probably damaging 1.00
IGL00563:Saxo1 APN 4 86445572 missense probably damaging 1.00
IGL01816:Saxo1 APN 4 86445614 missense probably benign 0.03
IGL02941:Saxo1 APN 4 86445584 missense probably damaging 1.00
IGL03139:Saxo1 APN 4 86487762 missense possibly damaging 0.49
R0498:Saxo1 UTSW 4 86478896 missense possibly damaging 0.78
R0522:Saxo1 UTSW 4 86445103 missense probably damaging 1.00
R1126:Saxo1 UTSW 4 86478987 missense probably benign 0.30
R2203:Saxo1 UTSW 4 86445761 missense probably damaging 1.00
R2261:Saxo1 UTSW 4 86478975 missense probably damaging 1.00
R2262:Saxo1 UTSW 4 86478975 missense probably damaging 1.00
R4017:Saxo1 UTSW 4 86557996 missense possibly damaging 0.82
R4629:Saxo1 UTSW 4 86487827 missense probably damaging 1.00
R5199:Saxo1 UTSW 4 86487782 missense probably damaging 1.00
R5471:Saxo1 UTSW 4 86445724 missense probably damaging 1.00
R5626:Saxo1 UTSW 4 86445589 missense probably damaging 1.00
R5679:Saxo1 UTSW 4 86445035 missense possibly damaging 0.89
R5710:Saxo1 UTSW 4 86445035 missense possibly damaging 0.89
R6900:Saxo1 UTSW 4 86445334 missense possibly damaging 0.94
R7035:Saxo1 UTSW 4 86445122 missense probably damaging 1.00
R7491:Saxo1 UTSW 4 86445407 missense probably benign 0.27
Z1176:Saxo1 UTSW 4 86445803 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTTAACGAAGCGCTTCTCCAC -3'
(R):5'- ACAGTGAGCTTAGGCACAAG -3'

Sequencing Primer
(F):5'- GGGGCACATAACTCATCTTGTAG -3'
(R):5'- CAAGATGATAGCAGGGATCTACTTTG -3'
Posted On2016-12-15