Mutagenetix > Incidental Mutation

Incidental Mutation 'R5782:Reln'

447786

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

MMRRC Submission

043379-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R5782 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21884454-22344702 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 22018056 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Lysine at position 993 (R993K)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000062372
AA Change: R993K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: R993K

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161356
AA Change: R993K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: R993K

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162427

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl9	A	T	17: 33,433,761 (GRCm38)	Q265L	probably benign	Het
Adamtsl3	T	A	7: 82,540,286 (GRCm38)		probably null	Het
Agt	A	T	8: 124,557,131 (GRCm38)		probably null	Het
Ankrd11	A	G	8: 122,900,017 (GRCm38)	L142P	probably damaging	Het
Arhgef19	C	A	4: 141,256,312 (GRCm38)	Q719K	probably damaging	Het
Armh3	A	G	19: 45,886,027 (GRCm38)	V569A	probably benign	Het
Atrnl1	G	T	19: 57,753,286 (GRCm38)	W1159L	possibly damaging	Het
Atxn2	T	C	5: 121,797,310 (GRCm38)	Y325H	probably damaging	Het
Brwd1	A	T	16: 96,043,043 (GRCm38)	Y770*	probably null	Het
Cdc20	T	C	4: 118,433,042 (GRCm38)	E474G	probably benign	Het
Cdk5rap3	A	G	11: 96,911,586 (GRCm38)	L254P	probably benign	Het
Cep83	A	T	10: 94,749,032 (GRCm38)	N333I	probably damaging	Het
Cox4i2	A	C	2: 152,764,811 (GRCm38)	D150A	probably damaging	Het
Cse1l	A	G	2: 166,929,001 (GRCm38)	I314M	probably damaging	Het
Cuedc1	A	G	11: 88,170,032 (GRCm38)	Y67C	probably damaging	Het
Cyp2j9	C	T	4: 96,573,905 (GRCm38)	V380I	probably benign	Het
Fancd2	A	G	6: 113,548,872 (GRCm38)	N302S	probably benign	Het
Foxa1	T	A	12: 57,542,516 (GRCm38)	H306L	probably benign	Het
Gse1	T	C	8: 120,566,521 (GRCm38)	S204P	probably damaging	Het
Hspa13	C	A	16: 75,758,097 (GRCm38)	R367L	probably damaging	Het
Kcnk2	T	G	1: 189,256,579 (GRCm38)	D267A	probably damaging	Het
Kctd18	A	G	1: 57,959,237 (GRCm38)	Y68H	probably damaging	Het
Khdc4	T	G	3: 88,711,678 (GRCm38)	V563G	probably damaging	Het
Klf7	C	T	1: 64,042,411 (GRCm38)	E253K	possibly damaging	Het
Lcn12	A	T	2: 25,493,757 (GRCm38)	F34I	probably damaging	Het
Lrrk2	A	T	15: 91,702,183 (GRCm38)	R401W	probably damaging	Het
Lzts1	A	T	8: 69,140,698 (GRCm38)	S86T	probably benign	Het
Mtres1	T	C	10: 43,532,903 (GRCm38)	I81M	probably benign	Het
Mtus1	T	A	8: 41,082,727 (GRCm38)	I651F	probably damaging	Het
Myl2	T	A	5: 122,104,870 (GRCm38)	F106L	probably damaging	Het
Neb	T	A	2: 52,264,047 (GRCm38)	K2351*	probably null	Het
Or14c45	T	A	7: 86,527,213 (GRCm38)	I152N	probably damaging	Het
Or52e5	T	C	7: 105,069,749 (GRCm38)	I94T	probably damaging	Het
Otogl	G	A	10: 107,777,117 (GRCm38)		silent	Het
Parg	A	T	14: 32,274,905 (GRCm38)	R318*	probably null	Het
Pcdhga3	C	T	18: 37,676,300 (GRCm38)	S602F	possibly damaging	Het
Pcnx2	A	G	8: 125,753,484 (GRCm38)	V2028A	probably damaging	Het
Pkhd1	T	C	1: 20,058,600 (GRCm38)	T3960A	probably benign	Het
Psen1	T	A	12: 83,712,459 (GRCm38)	H81Q	possibly damaging	Het
Psma6	A	G	12: 55,410,256 (GRCm38)	N109S	possibly damaging	Het
Ptpro	A	T	6: 137,399,498 (GRCm38)	I659F	possibly damaging	Het
Rap1gds1	C	G	3: 138,959,079 (GRCm38)	E288D	possibly damaging	Het
Saxo1	T	A	4: 86,445,807 (GRCm38)	L146F	probably damaging	Het
Six4	A	G	12: 73,104,058 (GRCm38)	V571A	probably benign	Het
Slc2a10	C	A	2: 165,514,838 (GRCm38)	Y139*	probably null	Het
Slc34a1	A	G	13: 55,402,688 (GRCm38)	I66V	possibly damaging	Het
Slfn8	G	T	11: 83,017,041 (GRCm38)	N46K	probably damaging	Het
Smc6	G	C	12: 11,290,834 (GRCm38)	A496P	probably damaging	Het
Stk31	T	G	6: 49,469,136 (GRCm38)	N902K	probably benign	Het
Stk36	T	A	1: 74,605,425 (GRCm38)	Y114N	possibly damaging	Het
Sult2b1	C	T	7: 45,731,346 (GRCm38)	V271M	probably damaging	Het
Tenm4	A	G	7: 96,893,039 (GRCm38)	I1920V	probably benign	Het
Trbc2	A	G	6: 41,546,937 (GRCm38)		probably benign	Het
Trpc2	A	G	7: 102,083,979 (GRCm38)	D419G	possibly damaging	Het
Trpm7	T	C	2: 126,797,714 (GRCm38)	N1654S	probably benign	Het
Tsku	A	T	7: 98,352,850 (GRCm38)	D91E	probably damaging	Het
Ttn	T	A	2: 76,776,011 (GRCm38)	R18151S	probably damaging	Het
Tyr	C	T	7: 87,493,016 (GRCm38)	C112Y	probably damaging	Het
Ubash3a	G	A	17: 31,235,503 (GRCm38)	G435S	probably benign	Het
Vav1	T	C	17: 57,296,001 (GRCm38)	I51T	probably damaging	Het
Vmn2r61	T	A	7: 42,299,829 (GRCm38)	C558S	probably damaging	Het
Zan	C	T	5: 137,420,007 (GRCm38)	C2943Y	unknown	Het
Zfp1002	T	C	2: 150,255,518 (GRCm38)	E25G	probably benign	Het
Zfp267	T	C	3: 36,164,979 (GRCm38)	S384P	possibly damaging	Het
Zfp318	TGAAGAAGAAGAAGAAGAAGAAGAAGAAG	TGAAGAAGAAGAAGAAGAAGAAG	17: 46,412,514 (GRCm38)		probably benign	Het
Zfp575	C	A	7: 24,585,602 (GRCm38)	G205C	possibly damaging	Het
Zfp740	G	T	15: 102,208,366 (GRCm38)		probably benign	Het
Zzz3	A	G	3: 152,428,100 (GRCm38)	E265G	possibly damaging	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22,010,127 (GRCm38)	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22,045,009 (GRCm38)	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22,154,950 (GRCm38)	missense	probably benign	0.01
IGL00755:Reln	APN	5	22,060,380 (GRCm38)	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22,018,850 (GRCm38)	critical splice donor site	probably null
IGL00900:Reln	APN	5	21,980,117 (GRCm38)	missense	probably damaging	0.98
IGL01067:Reln	APN	5	21,979,666 (GRCm38)	missense	probably damaging	1.00
IGL01104:Reln	APN	5	21,986,967 (GRCm38)	missense	probably damaging	0.99
IGL01141:Reln	APN	5	21,969,033 (GRCm38)	missense	probably damaging	1.00
IGL01141:Reln	APN	5	21,919,069 (GRCm38)	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22,171,251 (GRCm38)	missense	probably damaging	0.99
IGL01341:Reln	APN	5	21,969,079 (GRCm38)	missense	probably damaging	1.00
IGL01354:Reln	APN	5	21,919,175 (GRCm38)	nonsense	probably null
IGL01361:Reln	APN	5	21,919,021 (GRCm38)	missense	probably benign	0.06
IGL01446:Reln	APN	5	21,969,317 (GRCm38)	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22,040,405 (GRCm38)	missense	probably benign	0.40
IGL01612:Reln	APN	5	21,896,930 (GRCm38)	missense	probably damaging	0.99
IGL01695:Reln	APN	5	21,920,438 (GRCm38)	missense	probably damaging	1.00
IGL01718:Reln	APN	5	21,947,514 (GRCm38)	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22,344,246 (GRCm38)	nonsense	probably null
IGL01875:Reln	APN	5	21,904,717 (GRCm38)	missense	probably benign
IGL02013:Reln	APN	5	21,950,879 (GRCm38)	missense	probably damaging	1.00
IGL02031:Reln	APN	5	21,979,016 (GRCm38)	missense	probably damaging	0.99
IGL02186:Reln	APN	5	21,909,958 (GRCm38)	missense	probably damaging	1.00
IGL02228:Reln	APN	5	21,904,731 (GRCm38)	missense	probably damaging	0.99
IGL02248:Reln	APN	5	21,910,992 (GRCm38)	missense	probably damaging	1.00
IGL02336:Reln	APN	5	21,929,134 (GRCm38)	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22,080,791 (GRCm38)	nonsense	probably null
IGL02408:Reln	APN	5	21,901,619 (GRCm38)	missense	probably benign	0.44
IGL02415:Reln	APN	5	21,971,951 (GRCm38)	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22,040,427 (GRCm38)	missense	probably benign	0.00
IGL02540:Reln	APN	5	22,034,752 (GRCm38)	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22,103,357 (GRCm38)	missense	probably benign	0.09
IGL02720:Reln	APN	5	21,997,941 (GRCm38)	missense	probably damaging	0.99
IGL02894:Reln	APN	5	21,885,548 (GRCm38)	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	21,995,365 (GRCm38)	missense	probably damaging	1.00
IGL03125:Reln	APN	5	21,910,844 (GRCm38)	missense	probably damaging	1.00
IGL03298:Reln	APN	5	21,910,836 (GRCm38)	missense	probably damaging	0.99
Fishing	UTSW	5	21,896,841 (GRCm38)	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22,106,060 (GRCm38)	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22,286,896 (GRCm38)	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	21,925,371 (GRCm38)	missense	probably benign	0.01
R0105:Reln	UTSW	5	22,048,815 (GRCm38)	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22,048,815 (GRCm38)	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22,004,136 (GRCm38)	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22,128,649 (GRCm38)	missense	probably damaging	0.99
R0144:Reln	UTSW	5	21,948,449 (GRCm38)	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22,106,045 (GRCm38)	missense	probably benign	0.36
R0240:Reln	UTSW	5	22,106,045 (GRCm38)	missense	probably benign	0.36
R0242:Reln	UTSW	5	21,942,597 (GRCm38)	critical splice donor site	probably null
R0242:Reln	UTSW	5	21,942,597 (GRCm38)	critical splice donor site	probably null
R0266:Reln	UTSW	5	21,988,776 (GRCm38)	missense	probably damaging	1.00
R0269:Reln	UTSW	5	21,920,537 (GRCm38)	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22,227,513 (GRCm38)	splice site	probably benign
R0333:Reln	UTSW	5	21,929,242 (GRCm38)	missense	probably damaging	0.97
R0357:Reln	UTSW	5	21,950,822 (GRCm38)	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22,048,800 (GRCm38)	missense	probably damaging	0.98
R0506:Reln	UTSW	5	21,920,496 (GRCm38)	missense	probably damaging	0.97
R0534:Reln	UTSW	5	21,947,408 (GRCm38)	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22,051,276 (GRCm38)	splice site	probably benign
R0541:Reln	UTSW	5	21,980,109 (GRCm38)	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22,010,150 (GRCm38)	missense	probably benign	0.36
R0617:Reln	UTSW	5	21,920,537 (GRCm38)	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22,018,869 (GRCm38)	missense	probably damaging	1.00
R0653:Reln	UTSW	5	21,913,230 (GRCm38)	missense	probably benign	0.44
R0704:Reln	UTSW	5	21,896,811 (GRCm38)	missense	probably damaging	0.99
R0706:Reln	UTSW	5	21,896,811 (GRCm38)	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22,227,628 (GRCm38)	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22,034,664 (GRCm38)	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22,034,775 (GRCm38)	missense	probably benign
R1163:Reln	UTSW	5	21,899,029 (GRCm38)	missense	probably benign	0.03
R1222:Reln	UTSW	5	21,986,955 (GRCm38)	missense	probably null	0.97
R1226:Reln	UTSW	5	21,910,866 (GRCm38)	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22,128,602 (GRCm38)	splice site	probably benign
R1532:Reln	UTSW	5	22,034,744 (GRCm38)	missense	probably damaging	0.99
R1552:Reln	UTSW	5	21,960,378 (GRCm38)	missense	probably benign	0.01
R1565:Reln	UTSW	5	21,925,213 (GRCm38)	missense	probably benign	0.05
R1618:Reln	UTSW	5	22,060,368 (GRCm38)	missense	probably benign	0.01
R1636:Reln	UTSW	5	21,998,683 (GRCm38)	missense	probably damaging	0.99
R1664:Reln	UTSW	5	21,929,086 (GRCm38)	missense	probably damaging	1.00
R1716:Reln	UTSW	5	21,955,095 (GRCm38)	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22,010,289 (GRCm38)	missense	probably damaging	0.99
R1835:Reln	UTSW	5	21,979,002 (GRCm38)	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22,044,962 (GRCm38)	critical splice donor site	probably null
R1991:Reln	UTSW	5	21,969,360 (GRCm38)	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	21,942,627 (GRCm38)	missense	probably benign	0.01
R2072:Reln	UTSW	5	21,919,177 (GRCm38)	missense	probably damaging	1.00
R2103:Reln	UTSW	5	21,969,360 (GRCm38)	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22,019,000 (GRCm38)	missense	probably damaging	1.00
R2120:Reln	UTSW	5	21,969,085 (GRCm38)	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22,048,005 (GRCm38)	missense	probably benign	0.30
R2219:Reln	UTSW	5	21,972,047 (GRCm38)	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	21,987,078 (GRCm38)	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	21,896,786 (GRCm38)	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22,154,956 (GRCm38)	missense	probably benign	0.00
R2321:Reln	UTSW	5	21,915,020 (GRCm38)	missense	probably damaging	0.99
R2512:Reln	UTSW	5	21,979,690 (GRCm38)	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22,344,369 (GRCm38)	missense	unknown
R2870:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22,040,420 (GRCm38)	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22,227,600 (GRCm38)	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22,227,600 (GRCm38)	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22,227,600 (GRCm38)	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	21,995,589 (GRCm38)	splice site	probably benign
R3713:Reln	UTSW	5	21,904,734 (GRCm38)	missense	probably damaging	0.99
R3770:Reln	UTSW	5	21,948,566 (GRCm38)	missense	probably damaging	1.00
R3836:Reln	UTSW	5	21,911,014 (GRCm38)	missense	probably damaging	1.00
R3887:Reln	UTSW	5	21,910,849 (GRCm38)	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	21,979,001 (GRCm38)	missense	probably damaging	0.99
R3975:Reln	UTSW	5	21,995,366 (GRCm38)	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22,227,630 (GRCm38)	missense	probably benign	0.45
R4044:Reln	UTSW	5	22,128,632 (GRCm38)	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22,034,584 (GRCm38)	missense	probably damaging	1.00
R4297:Reln	UTSW	5	21,920,487 (GRCm38)	missense	probably damaging	0.99
R4298:Reln	UTSW	5	21,920,487 (GRCm38)	missense	probably damaging	0.99
R4299:Reln	UTSW	5	21,920,487 (GRCm38)	missense	probably damaging	0.99
R4518:Reln	UTSW	5	21,901,743 (GRCm38)	missense	probably benign	0.44
R4615:Reln	UTSW	5	21,972,872 (GRCm38)	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22,152,463 (GRCm38)	missense	probably benign	0.17
R4720:Reln	UTSW	5	22,286,896 (GRCm38)	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	21,919,222 (GRCm38)	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22,049,700 (GRCm38)	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22,344,185 (GRCm38)	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22,018,846 (GRCm38)	splice site	probably null
R4860:Reln	UTSW	5	21,901,751 (GRCm38)	missense	probably benign	0.06
R4860:Reln	UTSW	5	21,901,751 (GRCm38)	missense	probably benign	0.06
R4896:Reln	UTSW	5	21,955,238 (GRCm38)	missense	probably damaging	1.00
R4908:Reln	UTSW	5	21,979,720 (GRCm38)	missense	probably benign	0.02
R4912:Reln	UTSW	5	21,925,193 (GRCm38)	missense	probably benign	0.29
R4922:Reln	UTSW	5	21,995,587 (GRCm38)	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	21,960,426 (GRCm38)	missense	probably damaging	1.00
R4976:Reln	UTSW	5	21,971,870 (GRCm38)	missense	probably benign	0.05
R5020:Reln	UTSW	5	22,034,638 (GRCm38)	missense	probably damaging	1.00
R5037:Reln	UTSW	5	21,948,512 (GRCm38)	missense	probably damaging	1.00
R5082:Reln	UTSW	5	21,896,077 (GRCm38)	missense	probably benign	0.00
R5119:Reln	UTSW	5	21,971,870 (GRCm38)	missense	probably benign	0.05
R5125:Reln	UTSW	5	21,913,241 (GRCm38)	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	21,955,181 (GRCm38)	missense	probably damaging	1.00
R5152:Reln	UTSW	5	21,948,629 (GRCm38)	missense	probably damaging	1.00
R5154:Reln	UTSW	5	21,988,765 (GRCm38)	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22,103,397 (GRCm38)	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22,011,163 (GRCm38)	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22,039,529 (GRCm38)	missense	probably benign
R5400:Reln	UTSW	5	21,979,714 (GRCm38)	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22,004,203 (GRCm38)	missense	probably benign	0.00
R5514:Reln	UTSW	5	21,971,885 (GRCm38)	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	21,932,715 (GRCm38)	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22,039,665 (GRCm38)	nonsense	probably null
R5648:Reln	UTSW	5	21,998,572 (GRCm38)	missense	probably benign	0.04
R5649:Reln	UTSW	5	21,901,625 (GRCm38)	missense	probably benign	0.33
R5744:Reln	UTSW	5	22,106,083 (GRCm38)	missense	probably null	0.39
R5815:Reln	UTSW	5	21,947,433 (GRCm38)	missense	probably damaging	0.99
R5838:Reln	UTSW	5	21,899,113 (GRCm38)	missense	probably damaging	0.97
R6162:Reln	UTSW	5	21,911,050 (GRCm38)	missense	probably damaging	1.00
R6219:Reln	UTSW	5	21,948,596 (GRCm38)	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22,060,333 (GRCm38)	missense	probably damaging	0.99
R6279:Reln	UTSW	5	21,896,841 (GRCm38)	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22,286,944 (GRCm38)	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	21,896,841 (GRCm38)	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22,152,484 (GRCm38)	nonsense	probably null
R6351:Reln	UTSW	5	21,901,663 (GRCm38)	nonsense	probably null
R6369:Reln	UTSW	5	22,051,361 (GRCm38)	missense	probably benign	0.03
R6371:Reln	UTSW	5	21,995,513 (GRCm38)	missense	probably benign
R6374:Reln	UTSW	5	22,080,714 (GRCm38)	missense	probably benign	0.06
R6425:Reln	UTSW	5	21,911,020 (GRCm38)	nonsense	probably null
R6442:Reln	UTSW	5	21,932,776 (GRCm38)	missense	probably benign
R6445:Reln	UTSW	5	21,919,214 (GRCm38)	missense	probably benign	0.05
R6554:Reln	UTSW	5	21,896,840 (GRCm38)	missense	probably damaging	1.00
R6641:Reln	UTSW	5	21,929,134 (GRCm38)	missense	probably damaging	1.00
R6768:Reln	UTSW	5	21,978,907 (GRCm38)	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22,034,570 (GRCm38)	missense	probably damaging	1.00
R6896:Reln	UTSW	5	21,899,179 (GRCm38)	missense	probably benign	0.18
R6932:Reln	UTSW	5	21,985,857 (GRCm38)	missense	probably benign	0.00
R6948:Reln	UTSW	5	21,972,035 (GRCm38)	missense	probably damaging	1.00
R6959:Reln	UTSW	5	21,976,564 (GRCm38)	missense	probably damaging	1.00
R7085:Reln	UTSW	5	21,915,087 (GRCm38)	nonsense	probably null
R7091:Reln	UTSW	5	21,899,029 (GRCm38)	missense	probably null	0.08
R7135:Reln	UTSW	5	21,976,596 (GRCm38)	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22,106,097 (GRCm38)	missense	probably damaging	0.97
R7167:Reln	UTSW	5	21,942,620 (GRCm38)	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22,047,947 (GRCm38)	missense	probably damaging	1.00
R7256:Reln	UTSW	5	21,978,923 (GRCm38)	missense	probably benign	0.03
R7393:Reln	UTSW	5	21,976,351 (GRCm38)	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22,051,367 (GRCm38)	missense	probably damaging	0.99
R7400:Reln	UTSW	5	21,971,934 (GRCm38)	missense	probably damaging	0.99
R7426:Reln	UTSW	5	21,971,953 (GRCm38)	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22,103,435 (GRCm38)	missense	probably damaging	0.98
R7470:Reln	UTSW	5	21,942,741 (GRCm38)	missense	probably damaging	0.99
R7473:Reln	UTSW	5	21,929,127 (GRCm38)	missense	probably benign	0.25
R7501:Reln	UTSW	5	22,227,638 (GRCm38)	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	21,955,181 (GRCm38)	missense	probably damaging	1.00
R7544:Reln	UTSW	5	21,976,278 (GRCm38)	nonsense	probably null
R7588:Reln	UTSW	5	21,885,568 (GRCm38)	missense	probably benign	0.03
R7631:Reln	UTSW	5	21,971,935 (GRCm38)	missense	probably damaging	0.97
R7644:Reln	UTSW	5	21,978,931 (GRCm38)	missense	probably benign	0.39
R7834:Reln	UTSW	5	22,039,635 (GRCm38)	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22,134,692 (GRCm38)	missense	probably benign	0.00
R7938:Reln	UTSW	5	21,950,872 (GRCm38)	missense	probably damaging	0.97
R8006:Reln	UTSW	5	21,899,084 (GRCm38)	nonsense	probably null
R8062:Reln	UTSW	5	21,971,992 (GRCm38)	missense	probably benign	0.00
R8222:Reln	UTSW	5	21,931,477 (GRCm38)	nonsense	probably null
R8266:Reln	UTSW	5	22,018,087 (GRCm38)	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22,004,112 (GRCm38)	missense	probably damaging	1.00
R8487:Reln	UTSW	5	21,899,029 (GRCm38)	missense	probably benign	0.03
R8523:Reln	UTSW	5	22,004,231 (GRCm38)	missense	probably damaging	1.00
R8751:Reln	UTSW	5	21,942,674 (GRCm38)	missense	probably benign	0.37
R8801:Reln	UTSW	5	21,950,856 (GRCm38)	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	21,925,259 (GRCm38)	missense	probably damaging	0.98
R8978:Reln	UTSW	5	21,885,514 (GRCm38)	missense	possibly damaging	0.85
R8988:Reln	UTSW	5	21,899,157 (GRCm38)	missense	probably damaging	0.97
R8995:Reln	UTSW	5	21,979,579 (GRCm38)	missense	probably benign	0.00
R9022:Reln	UTSW	5	21,976,615 (GRCm38)	missense	possibly damaging	0.66
R9042:Reln	UTSW	5	22,048,038 (GRCm38)	missense	probably damaging	1.00
R9069:Reln	UTSW	5	22,011,061 (GRCm38)	missense	probably damaging	1.00
R9089:Reln	UTSW	5	21,925,200 (GRCm38)	missense	probably benign	0.01
R9126:Reln	UTSW	5	21,955,196 (GRCm38)	missense	probably damaging	1.00
R9172:Reln	UTSW	5	21,950,817 (GRCm38)	critical splice donor site	probably null
R9182:Reln	UTSW	5	21,901,619 (GRCm38)	missense	probably benign	0.44
R9196:Reln	UTSW	5	22,152,473 (GRCm38)	missense	probably damaging	1.00
R9211:Reln	UTSW	5	22,344,202 (GRCm38)	nonsense	probably null
R9241:Reln	UTSW	5	21,969,069 (GRCm38)	missense	probably damaging	0.99
R9244:Reln	UTSW	5	21,915,153 (GRCm38)	missense	probably damaging	0.99
R9281:Reln	UTSW	5	21,948,547 (GRCm38)	missense	probably damaging	1.00
R9295:Reln	UTSW	5	22,004,211 (GRCm38)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	21,988,707 (GRCm38)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22,080,691 (GRCm38)	missense	probably benign	0.01
R9309:Reln	UTSW	5	21,971,868 (GRCm38)	missense	probably benign	0.37
R9338:Reln	UTSW	5	21,997,939 (GRCm38)	missense	probably damaging	0.98
R9381:Reln	UTSW	5	22,344,204 (GRCm38)	missense	possibly damaging	0.93
R9430:Reln	UTSW	5	21,915,107 (GRCm38)	missense	probably damaging	1.00
R9509:Reln	UTSW	5	22,344,200 (GRCm38)	missense	possibly damaging	0.93
R9515:Reln	UTSW	5	21,920,510 (GRCm38)	missense	possibly damaging	0.46
R9717:Reln	UTSW	5	21,931,429 (GRCm38)	missense	probably benign	0.26
R9745:Reln	UTSW	5	21,947,527 (GRCm38)	missense	probably damaging	1.00
R9778:Reln	UTSW	5	21,950,945 (GRCm38)	missense	probably damaging	1.00
Z1176:Reln	UTSW	5	21,979,024 (GRCm38)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,004,082 (GRCm38)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	21,969,241 (GRCm38)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22,227,636 (GRCm38)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,154,959 (GRCm38)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CCCAGAGCAAGAATGGAAGT -3'
(R):5'- GCATTAGCTTTCTCAGAGGTTTT -3'

Sequencing Primer
(F):5'- AATCAGTACCTCCAGAGCTTGTG -3'
(R):5'- TTTTTCTCTTGCCGTGGGAAATG -3'

Posted On

2016-12-15