Incidental Mutation 'R5782:Myl2'
ID447789
Institutional Source Beutler Lab
Gene Symbol Myl2
Ensembl Gene ENSMUSG00000013936
Gene Namemyosin, light polypeptide 2, regulatory, cardiac, slow
SynonymsMlc2v, MLC-2v, MLC-2, Mylpc
MMRRC Submission 043379-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5782 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location122100951-122113472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122104870 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 106 (F106L)
Ref Sequence ENSEMBL: ENSMUSP00000107380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014080] [ENSMUST00000058960] [ENSMUST00000111750] [ENSMUST00000111751] [ENSMUST00000139213] [ENSMUST00000146733] [ENSMUST00000150535] [ENSMUST00000152389] [ENSMUST00000155612]
Predicted Effect probably damaging
Transcript: ENSMUST00000014080
AA Change: F106L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000014080
Gene: ENSMUSG00000013936
AA Change: F106L

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
EFh 134 162 3.97e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000058960
SMART Domains Protein: ENSMUSP00000050582
Gene: ENSMUSG00000043036

DomainStartEndE-ValueType
coiled coil region 140 158 N/A INTRINSIC
coiled coil region 209 285 N/A INTRINSIC
low complexity region 308 318 N/A INTRINSIC
coiled coil region 393 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111750
AA Change: F106L

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107379
Gene: ENSMUSG00000013936
AA Change: F106L

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111751
AA Change: F106L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107380
Gene: ENSMUSG00000013936
AA Change: F106L

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
EFh 134 162 3.97e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123913
Predicted Effect unknown
Transcript: ENSMUST00000126006
AA Change: F44L
SMART Domains Protein: ENSMUSP00000123261
Gene: ENSMUSG00000013936
AA Change: F44L

DomainStartEndE-ValueType
PDB:2W4H|B 2 62 4e-8 PDB
SCOP:d1wdcb_ 10 62 4e-5 SMART
Blast:EFh 37 62 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139213
AA Change: F87L

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114156
Gene: ENSMUSG00000013936
AA Change: F87L

DomainStartEndE-ValueType
Pfam:EF-hand_7 6 54 7e-8 PFAM
Pfam:EF-hand_1 9 37 6.4e-8 PFAM
Pfam:EF-hand_6 9 40 6.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146733
SMART Domains Protein: ENSMUSP00000142592
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
Pfam:EF-hand_7 6 54 1.2e-6 PFAM
Pfam:EF-hand_1 9 37 1.1e-6 PFAM
Pfam:EF-hand_6 9 40 1.1e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147178
Predicted Effect probably benign
Transcript: ENSMUST00000150535
AA Change: F87L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120274
Gene: ENSMUSG00000013936
AA Change: F87L

DomainStartEndE-ValueType
Pfam:EF-hand_7 6 54 6.2e-8 PFAM
Pfam:EF-hand_1 9 37 5.8e-8 PFAM
Pfam:EF-hand_6 9 40 5.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152744
Predicted Effect probably benign
Transcript: ENSMUST00000153816
SMART Domains Protein: ENSMUSP00000119627
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
Pfam:EF-hand_1 62 90 2.4e-8 PFAM
Pfam:EF-hand_6 62 91 7.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155612
AA Change: F87L

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120105
Gene: ENSMUSG00000013936
AA Change: F87L

DomainStartEndE-ValueType
EFh 9 37 2.81e-5 SMART
EFh 79 107 4.53e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198618
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a knock-in allele exhibit embryonic growth retardation and die between E12.5 and E14.5 with abnormal heart development characterized by a single ventricle, complete absence of the interventricular groove and septum, and a thin myocardium compact layer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,903 I81M probably benign Het
2810403A07Rik T G 3: 88,711,678 V563G probably damaging Het
9130011E15Rik A G 19: 45,886,027 V569A probably benign Het
Actl9 A T 17: 33,433,761 Q265L probably benign Het
Adamtsl3 T A 7: 82,540,286 probably null Het
Agt A T 8: 124,557,131 probably null Het
Ankrd11 A G 8: 122,900,017 L142P probably damaging Het
Arhgef19 C A 4: 141,256,312 Q719K probably damaging Het
Atrnl1 G T 19: 57,753,286 W1159L possibly damaging Het
Atxn2 T C 5: 121,797,310 Y325H probably damaging Het
Brwd1 A T 16: 96,043,043 Y770* probably null Het
Cdc20 T C 4: 118,433,042 E474G probably benign Het
Cdk5rap3 A G 11: 96,911,586 L254P probably benign Het
Cep83 A T 10: 94,749,032 N333I probably damaging Het
Cox4i2 A C 2: 152,764,811 D150A probably damaging Het
Cse1l A G 2: 166,929,001 I314M probably damaging Het
Cuedc1 A G 11: 88,170,032 Y67C probably damaging Het
Cyp2j9 C T 4: 96,573,905 V380I probably benign Het
D3Ertd254e T C 3: 36,164,979 S384P possibly damaging Het
Fancd2 A G 6: 113,548,872 N302S probably benign Het
Foxa1 T A 12: 57,542,516 H306L probably benign Het
Gm21994 T C 2: 150,255,518 E25G probably benign Het
Gse1 T C 8: 120,566,521 S204P probably damaging Het
Hspa13 C A 16: 75,758,097 R367L probably damaging Het
Kcnk2 T G 1: 189,256,579 D267A probably damaging Het
Kctd18 A G 1: 57,959,237 Y68H probably damaging Het
Klf7 C T 1: 64,042,411 E253K possibly damaging Het
Lcn12 A T 2: 25,493,757 F34I probably damaging Het
Lrrk2 A T 15: 91,702,183 R401W probably damaging Het
Lzts1 A T 8: 69,140,698 S86T probably benign Het
Mtus1 T A 8: 41,082,727 I651F probably damaging Het
Neb T A 2: 52,264,047 K2351* probably null Het
Olfr297 T A 7: 86,527,213 I152N probably damaging Het
Olfr678 T C 7: 105,069,749 I94T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Parg A T 14: 32,274,905 R318* probably null Het
Pcdhga3 C T 18: 37,676,300 S602F possibly damaging Het
Pcnx2 A G 8: 125,753,484 V2028A probably damaging Het
Pkhd1 T C 1: 20,058,600 T3960A probably benign Het
Psen1 T A 12: 83,712,459 H81Q possibly damaging Het
Psma6 A G 12: 55,410,256 N109S possibly damaging Het
Ptpro A T 6: 137,399,498 I659F possibly damaging Het
Rap1gds1 C G 3: 138,959,079 E288D possibly damaging Het
Reln C T 5: 22,018,056 R993K probably benign Het
Saxo1 T A 4: 86,445,807 L146F probably damaging Het
Six4 A G 12: 73,104,058 V571A probably benign Het
Slc2a10 C A 2: 165,514,838 Y139* probably null Het
Slc34a1 A G 13: 55,402,688 I66V possibly damaging Het
Slfn8 G T 11: 83,017,041 N46K probably damaging Het
Smc6 G C 12: 11,290,834 A496P probably damaging Het
Stk31 T G 6: 49,469,136 N902K probably benign Het
Stk36 T A 1: 74,605,425 Y114N possibly damaging Het
Sult2b1 C T 7: 45,731,346 V271M probably damaging Het
Tenm4 A G 7: 96,893,039 I1920V probably benign Het
Trbc2 A G 6: 41,546,937 probably benign Het
Trpc2 A G 7: 102,083,979 D419G possibly damaging Het
Trpm7 T C 2: 126,797,714 N1654S probably benign Het
Tsku A T 7: 98,352,850 D91E probably damaging Het
Ttn T A 2: 76,776,011 R18151S probably damaging Het
Tyr C T 7: 87,493,016 C112Y probably damaging Het
Ubash3a G A 17: 31,235,503 G435S probably benign Het
Vav1 T C 17: 57,296,001 I51T probably damaging Het
Vmn2r61 T A 7: 42,299,829 C558S probably damaging Het
Zan C T 5: 137,420,007 C2943Y unknown Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp575 C A 7: 24,585,602 G205C possibly damaging Het
Zfp740 G T 15: 102,208,366 probably benign Het
Zzz3 A G 3: 152,428,100 E265G possibly damaging Het
Other mutations in Myl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Myl2 APN 5 122106704 missense probably benign
R2879:Myl2 UTSW 5 122104685 critical splice donor site probably null
R4580:Myl2 UTSW 5 122106738 missense probably benign 0.37
R5569:Myl2 UTSW 5 122106720 missense possibly damaging 0.95
R6493:Myl2 UTSW 5 122106728 missense possibly damaging 0.64
R6560:Myl2 UTSW 5 122102771 missense probably null 1.00
R6878:Myl2 UTSW 5 122105077 missense probably benign
R7163:Myl2 UTSW 5 122101822 missense probably damaging 1.00
R7374:Myl2 UTSW 5 122101663 missense
Predicted Primers PCR Primer
(F):5'- CAGAGAAGTTGGCGTTGCTG -3'
(R):5'- AACACTGGAGACCCTGTACC -3'

Sequencing Primer
(F):5'- TACTGGTCCTTTGCGAGAACAGC -3'
(R):5'- GGAGACCCTGTACCTCCTC -3'
Posted On2016-12-15