Incidental Mutation 'R5782:Sult2b1'
ID447797
Institutional Source Beutler Lab
Gene Symbol Sult2b1
Ensembl Gene ENSMUSG00000003271
Gene Namesulfotransferase family, cytosolic, 2B, member 1
SynonymsSULT2B
MMRRC Submission 043379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5782 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45729983-45784669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45731346 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 271 (V271M)
Ref Sequence ENSEMBL: ENSMUSP00000148064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075571] [ENSMUST00000129507] [ENSMUST00000209739] [ENSMUST00000210147] [ENSMUST00000210754]
Predicted Effect probably damaging
Transcript: ENSMUST00000075571
AA Change: V237M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075005
Gene: ENSMUSG00000003271
AA Change: V237M

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 57 302 7.8e-84 PFAM
low complexity region 309 337 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107735
AA Change: V271M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103363
Gene: ENSMUSG00000003271
AA Change: V271M

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 91 336 5.2e-84 PFAM
Pfam:Sulfotransfer_3 92 262 5.1e-11 PFAM
low complexity region 343 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129507
SMART Domains Protein: ENSMUSP00000114397
Gene: ENSMUSG00000054161

DomainStartEndE-ValueType
Pfam:DUF1669 18 293 4.8e-105 PFAM
low complexity region 371 385 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209435
Predicted Effect probably damaging
Transcript: ENSMUST00000209739
AA Change: V269M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210147
Predicted Effect probably damaging
Transcript: ENSMUST00000210754
AA Change: V271M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211124
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene sulfates dehydroepiandrosterone but not 4-nitrophenol, a typical substrate for the phenol and estrogen sulfotransferase subfamilies. Two alternatively spliced variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack cholesterol sulfate in the dermis but otherwise appear to have normal lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,903 I81M probably benign Het
2810403A07Rik T G 3: 88,711,678 V563G probably damaging Het
9130011E15Rik A G 19: 45,886,027 V569A probably benign Het
Actl9 A T 17: 33,433,761 Q265L probably benign Het
Adamtsl3 T A 7: 82,540,286 probably null Het
Agt A T 8: 124,557,131 probably null Het
Ankrd11 A G 8: 122,900,017 L142P probably damaging Het
Arhgef19 C A 4: 141,256,312 Q719K probably damaging Het
Atrnl1 G T 19: 57,753,286 W1159L possibly damaging Het
Atxn2 T C 5: 121,797,310 Y325H probably damaging Het
Brwd1 A T 16: 96,043,043 Y770* probably null Het
Cdc20 T C 4: 118,433,042 E474G probably benign Het
Cdk5rap3 A G 11: 96,911,586 L254P probably benign Het
Cep83 A T 10: 94,749,032 N333I probably damaging Het
Cox4i2 A C 2: 152,764,811 D150A probably damaging Het
Cse1l A G 2: 166,929,001 I314M probably damaging Het
Cuedc1 A G 11: 88,170,032 Y67C probably damaging Het
Cyp2j9 C T 4: 96,573,905 V380I probably benign Het
D3Ertd254e T C 3: 36,164,979 S384P possibly damaging Het
Fancd2 A G 6: 113,548,872 N302S probably benign Het
Foxa1 T A 12: 57,542,516 H306L probably benign Het
Gm21994 T C 2: 150,255,518 E25G probably benign Het
Gse1 T C 8: 120,566,521 S204P probably damaging Het
Hspa13 C A 16: 75,758,097 R367L probably damaging Het
Kcnk2 T G 1: 189,256,579 D267A probably damaging Het
Kctd18 A G 1: 57,959,237 Y68H probably damaging Het
Klf7 C T 1: 64,042,411 E253K possibly damaging Het
Lcn12 A T 2: 25,493,757 F34I probably damaging Het
Lrrk2 A T 15: 91,702,183 R401W probably damaging Het
Lzts1 A T 8: 69,140,698 S86T probably benign Het
Mtus1 T A 8: 41,082,727 I651F probably damaging Het
Myl2 T A 5: 122,104,870 F106L probably damaging Het
Neb T A 2: 52,264,047 K2351* probably null Het
Olfr297 T A 7: 86,527,213 I152N probably damaging Het
Olfr678 T C 7: 105,069,749 I94T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Parg A T 14: 32,274,905 R318* probably null Het
Pcdhga3 C T 18: 37,676,300 S602F possibly damaging Het
Pcnx2 A G 8: 125,753,484 V2028A probably damaging Het
Pkhd1 T C 1: 20,058,600 T3960A probably benign Het
Psen1 T A 12: 83,712,459 H81Q possibly damaging Het
Psma6 A G 12: 55,410,256 N109S possibly damaging Het
Ptpro A T 6: 137,399,498 I659F possibly damaging Het
Rap1gds1 C G 3: 138,959,079 E288D possibly damaging Het
Reln C T 5: 22,018,056 R993K probably benign Het
Saxo1 T A 4: 86,445,807 L146F probably damaging Het
Six4 A G 12: 73,104,058 V571A probably benign Het
Slc2a10 C A 2: 165,514,838 Y139* probably null Het
Slc34a1 A G 13: 55,402,688 I66V possibly damaging Het
Slfn8 G T 11: 83,017,041 N46K probably damaging Het
Smc6 G C 12: 11,290,834 A496P probably damaging Het
Stk31 T G 6: 49,469,136 N902K probably benign Het
Stk36 T A 1: 74,605,425 Y114N possibly damaging Het
Tenm4 A G 7: 96,893,039 I1920V probably benign Het
Trbc2 A G 6: 41,546,937 probably benign Het
Trpc2 A G 7: 102,083,979 D419G possibly damaging Het
Trpm7 T C 2: 126,797,714 N1654S probably benign Het
Tsku A T 7: 98,352,850 D91E probably damaging Het
Ttn T A 2: 76,776,011 R18151S probably damaging Het
Tyr C T 7: 87,493,016 C112Y probably damaging Het
Ubash3a G A 17: 31,235,503 G435S probably benign Het
Vav1 T C 17: 57,296,001 I51T probably damaging Het
Vmn2r61 T A 7: 42,299,829 C558S probably damaging Het
Zan C T 5: 137,420,007 C2943Y unknown Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp575 C A 7: 24,585,602 G205C possibly damaging Het
Zfp740 G T 15: 102,208,366 probably benign Het
Zzz3 A G 3: 152,428,100 E265G possibly damaging Het
Other mutations in Sult2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02415:Sult2b1 APN 7 45742085 missense possibly damaging 0.86
IGL02964:Sult2b1 APN 7 45735274 missense probably benign 0.01
IGL03208:Sult2b1 APN 7 45733629 missense probably damaging 1.00
R0392:Sult2b1 UTSW 7 45733638 missense probably damaging 1.00
R0415:Sult2b1 UTSW 7 45730092 unclassified probably benign
R2247:Sult2b1 UTSW 7 45735310 missense probably damaging 1.00
R3851:Sult2b1 UTSW 7 45730037 unclassified probably benign
R3935:Sult2b1 UTSW 7 45742216 missense probably benign 0.09
R3936:Sult2b1 UTSW 7 45742216 missense probably benign 0.09
R4179:Sult2b1 UTSW 7 45735311 missense probably damaging 1.00
R4723:Sult2b1 UTSW 7 45742065 missense probably damaging 1.00
R5634:Sult2b1 UTSW 7 45734082 missense probably damaging 0.99
R6562:Sult2b1 UTSW 7 45742246 missense probably benign 0.00
R6816:Sult2b1 UTSW 7 45733678 missense probably damaging 1.00
R6921:Sult2b1 UTSW 7 45735188 missense probably damaging 1.00
R7145:Sult2b1 UTSW 7 45733632 missense probably damaging 1.00
R7250:Sult2b1 UTSW 7 45783937 missense unknown
R7392:Sult2b1 UTSW 7 45742438 start gained probably benign
R7398:Sult2b1 UTSW 7 45731294 missense probably damaging 1.00
R7691:Sult2b1 UTSW 7 45735284 missense probably benign 0.01
R7712:Sult2b1 UTSW 7 45730196 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TTCTGGGAAAATGGAGGCCC -3'
(R):5'- TGCTGAGCTGATTTCTGTCAAC -3'

Sequencing Primer
(F):5'- CCAGAAAGCCATGCAATTGG -3'
(R):5'- GAGCTGATTTCTGTCAACCTACAC -3'
Posted On2016-12-15