Incidental Mutation 'R5782:Adamtsl3'
ID447798
Institutional Source Beutler Lab
Gene Symbol Adamtsl3
Ensembl Gene ENSMUSG00000070469
Gene NameADAMTS-like 3
Synonymspunctin-2, 9230119C12Rik
MMRRC Submission 043379-MU
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5782 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location82335694-82614450 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 82540286 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]
Predicted Effect probably null
Transcript: ENSMUST00000173287
SMART Domains Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 90 136 6.43e-8 SMART
TSP1 355 414 1.59e-1 SMART
TSP1 433 492 3.72e-4 SMART
TSP1 494 547 4.28e-4 SMART
TSP1 579 638 1.85e-2 SMART
TSP1 660 717 1.75e-2 SMART
TSP1 719 773 3.45e-8 SMART
TSP1 775 833 3.67e-3 SMART
TSP1 836 894 8.99e-2 SMART
IGc2 938 1002 7.59e-4 SMART
IG 1213 1296 4.87e0 SMART
IGc2 1326 1388 1.01e-13 SMART
TSP1 1441 1498 1.95e-2 SMART
TSP1 1500 1559 6.76e-2 SMART
TSP1 1616 1666 3.84e-1 SMART
Pfam:PLAC 1674 1704 2.4e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173828
SMART Domains Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 22 79 1e-26 BLAST
SCOP:d1biha4 27 77 2e-5 SMART
IG 283 366 4.87e0 SMART
IGc2 396 458 1.01e-13 SMART
TSP1 511 568 1.95e-2 SMART
TSP1 570 629 6.76e-2 SMART
TSP1 686 736 3.84e-1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype Strain: 3605825
Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. (SEE BELOW)
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,903 I81M probably benign Het
2810403A07Rik T G 3: 88,711,678 V563G probably damaging Het
9130011E15Rik A G 19: 45,886,027 V569A probably benign Het
Actl9 A T 17: 33,433,761 Q265L probably benign Het
Agt A T 8: 124,557,131 probably null Het
Ankrd11 A G 8: 122,900,017 L142P probably damaging Het
Arhgef19 C A 4: 141,256,312 Q719K probably damaging Het
Atrnl1 G T 19: 57,753,286 W1159L possibly damaging Het
Atxn2 T C 5: 121,797,310 Y325H probably damaging Het
Brwd1 A T 16: 96,043,043 Y770* probably null Het
Cdc20 T C 4: 118,433,042 E474G probably benign Het
Cdk5rap3 A G 11: 96,911,586 L254P probably benign Het
Cep83 A T 10: 94,749,032 N333I probably damaging Het
Cox4i2 A C 2: 152,764,811 D150A probably damaging Het
Cse1l A G 2: 166,929,001 I314M probably damaging Het
Cuedc1 A G 11: 88,170,032 Y67C probably damaging Het
Cyp2j9 C T 4: 96,573,905 V380I probably benign Het
D3Ertd254e T C 3: 36,164,979 S384P possibly damaging Het
Fancd2 A G 6: 113,548,872 N302S probably benign Het
Foxa1 T A 12: 57,542,516 H306L probably benign Het
Gm21994 T C 2: 150,255,518 E25G probably benign Het
Gse1 T C 8: 120,566,521 S204P probably damaging Het
Hspa13 C A 16: 75,758,097 R367L probably damaging Het
Kcnk2 T G 1: 189,256,579 D267A probably damaging Het
Kctd18 A G 1: 57,959,237 Y68H probably damaging Het
Klf7 C T 1: 64,042,411 E253K possibly damaging Het
Lcn12 A T 2: 25,493,757 F34I probably damaging Het
Lrrk2 A T 15: 91,702,183 R401W probably damaging Het
Lzts1 A T 8: 69,140,698 S86T probably benign Het
Mtus1 T A 8: 41,082,727 I651F probably damaging Het
Myl2 T A 5: 122,104,870 F106L probably damaging Het
Neb T A 2: 52,264,047 K2351* probably null Het
Olfr297 T A 7: 86,527,213 I152N probably damaging Het
Olfr678 T C 7: 105,069,749 I94T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Parg A T 14: 32,274,905 R318* probably null Het
Pcdhga3 C T 18: 37,676,300 S602F possibly damaging Het
Pcnx2 A G 8: 125,753,484 V2028A probably damaging Het
Pkhd1 T C 1: 20,058,600 T3960A probably benign Het
Psen1 T A 12: 83,712,459 H81Q possibly damaging Het
Psma6 A G 12: 55,410,256 N109S possibly damaging Het
Ptpro A T 6: 137,399,498 I659F possibly damaging Het
Rap1gds1 C G 3: 138,959,079 E288D possibly damaging Het
Reln C T 5: 22,018,056 R993K probably benign Het
Saxo1 T A 4: 86,445,807 L146F probably damaging Het
Six4 A G 12: 73,104,058 V571A probably benign Het
Slc2a10 C A 2: 165,514,838 Y139* probably null Het
Slc34a1 A G 13: 55,402,688 I66V possibly damaging Het
Slfn8 G T 11: 83,017,041 N46K probably damaging Het
Smc6 G C 12: 11,290,834 A496P probably damaging Het
Stk31 T G 6: 49,469,136 N902K probably benign Het
Stk36 T A 1: 74,605,425 Y114N possibly damaging Het
Sult2b1 C T 7: 45,731,346 V271M probably damaging Het
Tenm4 A G 7: 96,893,039 I1920V probably benign Het
Trbc2 A G 6: 41,546,937 probably benign Het
Trpc2 A G 7: 102,083,979 D419G possibly damaging Het
Trpm7 T C 2: 126,797,714 N1654S probably benign Het
Tsku A T 7: 98,352,850 D91E probably damaging Het
Ttn T A 2: 76,776,011 R18151S probably damaging Het
Tyr C T 7: 87,493,016 C112Y probably damaging Het
Ubash3a G A 17: 31,235,503 G435S probably benign Het
Vav1 T C 17: 57,296,001 I51T probably damaging Het
Vmn2r61 T A 7: 42,299,829 C558S probably damaging Het
Zan C T 5: 137,420,007 C2943Y unknown Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp575 C A 7: 24,585,602 G205C possibly damaging Het
Zfp740 G T 15: 102,208,366 probably benign Het
Zzz3 A G 3: 152,428,100 E265G possibly damaging Het
Other mutations in Adamtsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Adamtsl3 APN 7 82612448 missense probably damaging 1.00
IGL01936:Adamtsl3 APN 7 82595371 missense possibly damaging 0.93
IGL02819:Adamtsl3 APN 7 82574121 missense probably damaging 0.99
P0012:Adamtsl3 UTSW 7 82574257 missense probably benign 0.27
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0180:Adamtsl3 UTSW 7 82575990 missense probably benign 0.00
R0270:Adamtsl3 UTSW 7 82556824 missense probably damaging 1.00
R0295:Adamtsl3 UTSW 7 82548005 critical splice donor site probably null
R0329:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0330:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0548:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R0611:Adamtsl3 UTSW 7 82528912 missense probably damaging 1.00
R0671:Adamtsl3 UTSW 7 82523182 missense probably damaging 1.00
R0711:Adamtsl3 UTSW 7 82465699 intron probably benign
R0845:Adamtsl3 UTSW 7 82575996 missense probably damaging 1.00
R1119:Adamtsl3 UTSW 7 82540317 missense probably damaging 0.96
R1458:Adamtsl3 UTSW 7 82523320 missense probably damaging 1.00
R1644:Adamtsl3 UTSW 7 82450090 missense possibly damaging 0.87
R1691:Adamtsl3 UTSW 7 82499606 missense probably damaging 1.00
R1838:Adamtsl3 UTSW 7 82493373 missense probably damaging 1.00
R2131:Adamtsl3 UTSW 7 82578594 missense probably damaging 1.00
R2245:Adamtsl3 UTSW 7 82450100 missense probably damaging 1.00
R2274:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2275:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2448:Adamtsl3 UTSW 7 82499748 missense probably damaging 1.00
R3725:Adamtsl3 UTSW 7 82612404 missense possibly damaging 0.80
R3757:Adamtsl3 UTSW 7 82337207 missense probably benign 0.01
R3821:Adamtsl3 UTSW 7 82606479 splice site probably benign
R4618:Adamtsl3 UTSW 7 82606520 missense probably benign 0.41
R4842:Adamtsl3 UTSW 7 82528861 missense probably damaging 1.00
R4887:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4888:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4925:Adamtsl3 UTSW 7 82602299 critical splice donor site probably null
R4960:Adamtsl3 UTSW 7 82566977 missense probably damaging 0.99
R5026:Adamtsl3 UTSW 7 82576054 missense probably benign 0.07
R5152:Adamtsl3 UTSW 7 82574544 missense probably benign 0.11
R5198:Adamtsl3 UTSW 7 82611798 missense possibly damaging 0.63
R5244:Adamtsl3 UTSW 7 82598069 missense probably benign 0.02
R5281:Adamtsl3 UTSW 7 82528934 missense probably damaging 1.00
R5323:Adamtsl3 UTSW 7 82557061 missense probably damaging 1.00
R5523:Adamtsl3 UTSW 7 82574442 missense possibly damaging 0.86
R5602:Adamtsl3 UTSW 7 82557239 missense possibly damaging 0.89
R5638:Adamtsl3 UTSW 7 82611750 missense probably damaging 0.99
R5682:Adamtsl3 UTSW 7 82606550 missense probably damaging 0.99
R5946:Adamtsl3 UTSW 7 82576057 missense probably damaging 0.98
R6091:Adamtsl3 UTSW 7 82465621 missense probably damaging 1.00
R6258:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R6500:Adamtsl3 UTSW 7 82578610 missense probably benign 0.00
R6765:Adamtsl3 UTSW 7 82567024 missense possibly damaging 0.60
R6785:Adamtsl3 UTSW 7 82522004 missense probably damaging 0.99
R6982:Adamtsl3 UTSW 7 82515063 missense probably damaging 1.00
R7109:Adamtsl3 UTSW 7 82611861 missense
R7341:Adamtsl3 UTSW 7 82556874 missense probably damaging 1.00
R7402:Adamtsl3 UTSW 7 82578617 missense probably damaging 0.96
R7506:Adamtsl3 UTSW 7 82514978 missense probably damaging 1.00
R7549:Adamtsl3 UTSW 7 82573909 missense probably damaging 1.00
R7575:Adamtsl3 UTSW 7 82574548 missense possibly damaging 0.85
R7592:Adamtsl3 UTSW 7 82337251 missense probably benign 0.00
R7654:Adamtsl3 UTSW 7 82574494 missense probably benign
R7721:Adamtsl3 UTSW 7 82606520 missense possibly damaging 0.62
X0003:Adamtsl3 UTSW 7 82611759 nonsense probably null
X0063:Adamtsl3 UTSW 7 82574157 missense probably benign 0.25
Z1088:Adamtsl3 UTSW 7 82499714 missense probably damaging 1.00
Z1088:Adamtsl3 UTSW 7 82540325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAATGTGTCACACTGGTC -3'
(R):5'- ACCCAGTTCTCGAGACACAG -3'

Sequencing Primer
(F):5'- GTCACACTGGTCTTAGCATGGAAC -3'
(R):5'- TTCTCGAGACACAGGGCTCTG -3'
Posted On2016-12-15