Incidental Mutation 'R5782:Agt'
ID447810
Institutional Source Beutler Lab
Gene Symbol Agt
Ensembl Gene ENSMUSG00000031980
Gene Nameangiotensinogen (serpin peptidase inhibitor, clade A, member 8)
SynonymsAogen, angiotensin precursor, Serpina8
MMRRC Submission 043379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5782 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location124556534-124569706 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 124557131 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063278]
Predicted Effect probably null
Transcript: ENSMUST00000063278
SMART Domains Protein: ENSMUSP00000066488
Gene: ENSMUSG00000031980

DomainStartEndE-ValueType
SERPIN 111 478 6.63e-57 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the liver and is cleaved by the enzyme renin in response to lowered blood pressure. The resulting product, angiotensin I, is then cleaved by angiotensin converting enzyme (ACE) to generate the physiologically active enzyme angiotensin II. The protein is involved in maintaining blood pressure and in the pathogenesis of essential hypertension and preeclampsia. Mutations in this gene are associated with susceptibility to essential hypertension, and can cause renal tubular dysgenesis, a severe disorder of renal tubular development. Defects in this gene have also been associated with non-familial structural atrial fibrillation, and inflammatory bowel disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutation of this gene results in small body size and lower body fat, decreased blood pressure and hypotension, kidney abnormalities, polydipsia and polyuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,903 I81M probably benign Het
2810403A07Rik T G 3: 88,711,678 V563G probably damaging Het
9130011E15Rik A G 19: 45,886,027 V569A probably benign Het
Actl9 A T 17: 33,433,761 Q265L probably benign Het
Adamtsl3 T A 7: 82,540,286 probably null Het
Ankrd11 A G 8: 122,900,017 L142P probably damaging Het
Arhgef19 C A 4: 141,256,312 Q719K probably damaging Het
Atrnl1 G T 19: 57,753,286 W1159L possibly damaging Het
Atxn2 T C 5: 121,797,310 Y325H probably damaging Het
Brwd1 A T 16: 96,043,043 Y770* probably null Het
Cdc20 T C 4: 118,433,042 E474G probably benign Het
Cdk5rap3 A G 11: 96,911,586 L254P probably benign Het
Cep83 A T 10: 94,749,032 N333I probably damaging Het
Cox4i2 A C 2: 152,764,811 D150A probably damaging Het
Cse1l A G 2: 166,929,001 I314M probably damaging Het
Cuedc1 A G 11: 88,170,032 Y67C probably damaging Het
Cyp2j9 C T 4: 96,573,905 V380I probably benign Het
D3Ertd254e T C 3: 36,164,979 S384P possibly damaging Het
Fancd2 A G 6: 113,548,872 N302S probably benign Het
Foxa1 T A 12: 57,542,516 H306L probably benign Het
Gm21994 T C 2: 150,255,518 E25G probably benign Het
Gse1 T C 8: 120,566,521 S204P probably damaging Het
Hspa13 C A 16: 75,758,097 R367L probably damaging Het
Kcnk2 T G 1: 189,256,579 D267A probably damaging Het
Kctd18 A G 1: 57,959,237 Y68H probably damaging Het
Klf7 C T 1: 64,042,411 E253K possibly damaging Het
Lcn12 A T 2: 25,493,757 F34I probably damaging Het
Lrrk2 A T 15: 91,702,183 R401W probably damaging Het
Lzts1 A T 8: 69,140,698 S86T probably benign Het
Mtus1 T A 8: 41,082,727 I651F probably damaging Het
Myl2 T A 5: 122,104,870 F106L probably damaging Het
Neb T A 2: 52,264,047 K2351* probably null Het
Olfr297 T A 7: 86,527,213 I152N probably damaging Het
Olfr678 T C 7: 105,069,749 I94T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Parg A T 14: 32,274,905 R318* probably null Het
Pcdhga3 C T 18: 37,676,300 S602F possibly damaging Het
Pcnx2 A G 8: 125,753,484 V2028A probably damaging Het
Pkhd1 T C 1: 20,058,600 T3960A probably benign Het
Psen1 T A 12: 83,712,459 H81Q possibly damaging Het
Psma6 A G 12: 55,410,256 N109S possibly damaging Het
Ptpro A T 6: 137,399,498 I659F possibly damaging Het
Rap1gds1 C G 3: 138,959,079 E288D possibly damaging Het
Reln C T 5: 22,018,056 R993K probably benign Het
Saxo1 T A 4: 86,445,807 L146F probably damaging Het
Six4 A G 12: 73,104,058 V571A probably benign Het
Slc2a10 C A 2: 165,514,838 Y139* probably null Het
Slc34a1 A G 13: 55,402,688 I66V possibly damaging Het
Slfn8 G T 11: 83,017,041 N46K probably damaging Het
Smc6 G C 12: 11,290,834 A496P probably damaging Het
Stk31 T G 6: 49,469,136 N902K probably benign Het
Stk36 T A 1: 74,605,425 Y114N possibly damaging Het
Sult2b1 C T 7: 45,731,346 V271M probably damaging Het
Tenm4 A G 7: 96,893,039 I1920V probably benign Het
Trbc2 A G 6: 41,546,937 probably benign Het
Trpc2 A G 7: 102,083,979 D419G possibly damaging Het
Trpm7 T C 2: 126,797,714 N1654S probably benign Het
Tsku A T 7: 98,352,850 D91E probably damaging Het
Ttn T A 2: 76,776,011 R18151S probably damaging Het
Tyr C T 7: 87,493,016 C112Y probably damaging Het
Ubash3a G A 17: 31,235,503 G435S probably benign Het
Vav1 T C 17: 57,296,001 I51T probably damaging Het
Vmn2r61 T A 7: 42,299,829 C558S probably damaging Het
Zan C T 5: 137,420,007 C2943Y unknown Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp575 C A 7: 24,585,602 G205C possibly damaging Het
Zfp740 G T 15: 102,208,366 probably benign Het
Zzz3 A G 3: 152,428,100 E265G possibly damaging Het
Other mutations in Agt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Agt APN 8 124557895 splice site probably benign
IGL01648:Agt APN 8 124564406 missense probably benign 0.01
IGL02145:Agt APN 8 124564448 missense probably damaging 0.99
IGL02929:Agt APN 8 124557090 missense probably benign
IGL02978:Agt APN 8 124557763 missense possibly damaging 0.93
IGL03207:Agt APN 8 124559368 missense probably damaging 0.98
R0518:Agt UTSW 8 124557100 nonsense probably null
R0521:Agt UTSW 8 124557100 nonsense probably null
R0562:Agt UTSW 8 124559275 missense probably benign 0.00
R0591:Agt UTSW 8 124556939 missense possibly damaging 0.77
R0646:Agt UTSW 8 124557113 missense probably damaging 1.00
R1495:Agt UTSW 8 124559455 missense probably damaging 1.00
R2568:Agt UTSW 8 124556955 missense probably damaging 1.00
R4750:Agt UTSW 8 124556937 missense probably benign
R4941:Agt UTSW 8 124556988 missense probably benign 0.32
R5916:Agt UTSW 8 124563858 missense possibly damaging 0.70
R6332:Agt UTSW 8 124557833 missense possibly damaging 0.92
R7769:Agt UTSW 8 124564550 missense probably benign 0.41
X0067:Agt UTSW 8 124556955 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACTCTGCCCAGAAAGTG -3'
(R):5'- TGACCCCACTGTGCTGTTTAG -3'

Sequencing Primer
(F):5'- AAAGTGCAGCGTGCCTG -3'
(R):5'- TACCAAGATGGCAGGTGAAC -3'
Posted On2016-12-15