Incidental Mutation 'R5782:Lrrk2'
ID 447827
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Name leucine-rich repeat kinase 2
Synonyms 9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik
MMRRC Submission 043379-MU
Accession Numbers

Genbank: NM_025730; MGI: 1913975
Essential gene? Possibly essential (E-score: 0.533) question?
Stock # R5782 (G1)
Quality Score 212
Status Not validated
Chromosome 15
Chromosomal Location 91673175-91816120 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 91702183 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 401 (R401W)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
AlphaFold Q5S006
Predicted Effect probably damaging
Transcript: ENSMUST00000060642
AA Change: R401W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: R401W

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,903 I81M probably benign Het
2810403A07Rik T G 3: 88,711,678 V563G probably damaging Het
9130011E15Rik A G 19: 45,886,027 V569A probably benign Het
Actl9 A T 17: 33,433,761 Q265L probably benign Het
Adamtsl3 T A 7: 82,540,286 probably null Het
Agt A T 8: 124,557,131 probably null Het
Ankrd11 A G 8: 122,900,017 L142P probably damaging Het
Arhgef19 C A 4: 141,256,312 Q719K probably damaging Het
Atrnl1 G T 19: 57,753,286 W1159L possibly damaging Het
Atxn2 T C 5: 121,797,310 Y325H probably damaging Het
Brwd1 A T 16: 96,043,043 Y770* probably null Het
Cdc20 T C 4: 118,433,042 E474G probably benign Het
Cdk5rap3 A G 11: 96,911,586 L254P probably benign Het
Cep83 A T 10: 94,749,032 N333I probably damaging Het
Cox4i2 A C 2: 152,764,811 D150A probably damaging Het
Cse1l A G 2: 166,929,001 I314M probably damaging Het
Cuedc1 A G 11: 88,170,032 Y67C probably damaging Het
Cyp2j9 C T 4: 96,573,905 V380I probably benign Het
D3Ertd254e T C 3: 36,164,979 S384P possibly damaging Het
Fancd2 A G 6: 113,548,872 N302S probably benign Het
Foxa1 T A 12: 57,542,516 H306L probably benign Het
Gm21994 T C 2: 150,255,518 E25G probably benign Het
Gse1 T C 8: 120,566,521 S204P probably damaging Het
Hspa13 C A 16: 75,758,097 R367L probably damaging Het
Kcnk2 T G 1: 189,256,579 D267A probably damaging Het
Kctd18 A G 1: 57,959,237 Y68H probably damaging Het
Klf7 C T 1: 64,042,411 E253K possibly damaging Het
Lcn12 A T 2: 25,493,757 F34I probably damaging Het
Lzts1 A T 8: 69,140,698 S86T probably benign Het
Mtus1 T A 8: 41,082,727 I651F probably damaging Het
Myl2 T A 5: 122,104,870 F106L probably damaging Het
Neb T A 2: 52,264,047 K2351* probably null Het
Olfr297 T A 7: 86,527,213 I152N probably damaging Het
Olfr678 T C 7: 105,069,749 I94T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Parg A T 14: 32,274,905 R318* probably null Het
Pcdhga3 C T 18: 37,676,300 S602F possibly damaging Het
Pcnx2 A G 8: 125,753,484 V2028A probably damaging Het
Pkhd1 T C 1: 20,058,600 T3960A probably benign Het
Psen1 T A 12: 83,712,459 H81Q possibly damaging Het
Psma6 A G 12: 55,410,256 N109S possibly damaging Het
Ptpro A T 6: 137,399,498 I659F possibly damaging Het
Rap1gds1 C G 3: 138,959,079 E288D possibly damaging Het
Reln C T 5: 22,018,056 R993K probably benign Het
Saxo1 T A 4: 86,445,807 L146F probably damaging Het
Six4 A G 12: 73,104,058 V571A probably benign Het
Slc2a10 C A 2: 165,514,838 Y139* probably null Het
Slc34a1 A G 13: 55,402,688 I66V possibly damaging Het
Slfn8 G T 11: 83,017,041 N46K probably damaging Het
Smc6 G C 12: 11,290,834 A496P probably damaging Het
Stk31 T G 6: 49,469,136 N902K probably benign Het
Stk36 T A 1: 74,605,425 Y114N possibly damaging Het
Sult2b1 C T 7: 45,731,346 V271M probably damaging Het
Tenm4 A G 7: 96,893,039 I1920V probably benign Het
Trbc2 A G 6: 41,546,937 probably benign Het
Trpc2 A G 7: 102,083,979 D419G possibly damaging Het
Trpm7 T C 2: 126,797,714 N1654S probably benign Het
Tsku A T 7: 98,352,850 D91E probably damaging Het
Ttn T A 2: 76,776,011 R18151S probably damaging Het
Tyr C T 7: 87,493,016 C112Y probably damaging Het
Ubash3a G A 17: 31,235,503 G435S probably benign Het
Vav1 T C 17: 57,296,001 I51T probably damaging Het
Vmn2r61 T A 7: 42,299,829 C558S probably damaging Het
Zan C T 5: 137,420,007 C2943Y unknown Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp575 C A 7: 24,585,602 G205C possibly damaging Het
Zfp740 G T 15: 102,208,366 probably benign Het
Zzz3 A G 3: 152,428,100 E265G possibly damaging Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91747799 missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91699943 missense probably benign
IGL00770:Lrrk2 APN 15 91801833 splice site probably benign
IGL00774:Lrrk2 APN 15 91801833 splice site probably benign
IGL00791:Lrrk2 APN 15 91779841 missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91755790 missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91757058 missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91738832 missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91726137 missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91683142 missense probably benign
IGL01301:Lrrk2 APN 15 91767339 missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91700569 splice site probably null
IGL01465:Lrrk2 APN 15 91728925 missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91812313 missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91699989 missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91774988 missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91779946 missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91731491 missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91726308 critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91685822 missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91750277 missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91747755 missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91700578 missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91797414 splice site probably null
horned UTSW 15 91772858 missense probably damaging 1.00
R1312_Lrrk2_980 UTSW 15 91699895 missense probably damaging 1.00
R4710_lrrk2_232 UTSW 15 91699927 missense possibly damaging 0.88
R5245_Lrrk2_127 UTSW 15 91796089 missense probably damaging 1.00
spree UTSW 15 91702247 missense probably benign 0.00
Spur UTSW 15 91774995 nonsense probably null
3-1:Lrrk2 UTSW 15 91801934 missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91767339 missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91673358 missense probably benign
H8786:Lrrk2 UTSW 15 91673358 missense probably benign
IGL02835:Lrrk2 UTSW 15 91814660 critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0078:Lrrk2 UTSW 15 91734009 missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91745796 missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91778414 splice site probably benign
R0448:Lrrk2 UTSW 15 91709305 missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91750275 missense probably damaging 1.00
R0610:Lrrk2 UTSW 15 91815416 missense probably benign
R0617:Lrrk2 UTSW 15 91752278 missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91796028 missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91772996 missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91757070 critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91775046 splice site probably null
R0766:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91755962 missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91729081 missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91729169 missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91673689 missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91700468 nonsense probably null
R1223:Lrrk2 UTSW 15 91673635 missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91812360 missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91728920 missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91734058 missense probably benign
R1773:Lrrk2 UTSW 15 91779981 missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91699892 missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91683134 missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91736661 splice site probably null
R2160:Lrrk2 UTSW 15 91796060 missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91764716 missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91797526 splice site probably benign
R2516:Lrrk2 UTSW 15 91755927 missense probably benign
R3110:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91737111 missense probably benign
R3842:Lrrk2 UTSW 15 91755916 missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91747700 missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91747701 missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91767461 critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91712780 missense possibly damaging 0.69
R3938:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3982:Lrrk2 UTSW 15 91709284 missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91815483 missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91755794 missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R4465:Lrrk2 UTSW 15 91747820 missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91723188 missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91705120 missense probably benign
R4539:Lrrk2 UTSW 15 91729142 missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91765681 missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91699927 missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91688901 missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91764759 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91712828 missense probably benign
R4945:Lrrk2 UTSW 15 91804920 missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91803389 missense probably benign 0.20
R5000:Lrrk2 UTSW 15 91749878 missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91700619 missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91765790 missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91796089 missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91814644 splice site probably null
R5551:Lrrk2 UTSW 15 91812350 missense probably benign
R5574:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91765745 missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91803301 nonsense probably null
R5712:Lrrk2 UTSW 15 91702222 nonsense probably null
R5728:Lrrk2 UTSW 15 91774974 missense probably benign 0.36
R5788:Lrrk2 UTSW 15 91764648 missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91709390 critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91755949 missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91734046 missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91745831 missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91772945 missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91723135 missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91747826 missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91702247 missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91742266 missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91723218 missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91774995 nonsense probably null
R7072:Lrrk2 UTSW 15 91801920 missense probably benign 0.03
R7109:Lrrk2 UTSW 15 91764782 missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91801885 missense probably benign
R7144:Lrrk2 UTSW 15 91734055 missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91757001 missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91700441 missense probably benign 0.01
R7356:Lrrk2 UTSW 15 91738744 missense probably benign 0.07
R7360:Lrrk2 UTSW 15 91731655 critical splice donor site probably null
R7373:Lrrk2 UTSW 15 91700004 critical splice donor site probably null
R7465:Lrrk2 UTSW 15 91767340 missense probably damaging 1.00
R7477:Lrrk2 UTSW 15 91812325 missense probably damaging 0.98
R7614:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R7622:Lrrk2 UTSW 15 91812323 missense probably damaging 1.00
R7658:Lrrk2 UTSW 15 91700358 missense possibly damaging 0.91
R7679:Lrrk2 UTSW 15 91726186 missense possibly damaging 0.58
R7737:Lrrk2 UTSW 15 91815446 missense probably damaging 0.98
R7739:Lrrk2 UTSW 15 91700613 missense probably damaging 1.00
R7740:Lrrk2 UTSW 15 91767324 missense probably damaging 1.00
R7908:Lrrk2 UTSW 15 91726152 missense probably damaging 1.00
R8299:Lrrk2 UTSW 15 91673240 start gained probably benign
R8389:Lrrk2 UTSW 15 91699991 missense probably damaging 1.00
R8462:Lrrk2 UTSW 15 91731477 missense probably benign
R8698:Lrrk2 UTSW 15 91752197 missense probably benign 0.38
R8947:Lrrk2 UTSW 15 91702270 nonsense probably null
R9084:Lrrk2 UTSW 15 91750266 missense
R9086:Lrrk2 UTSW 15 91755848 missense probably benign 0.01
R9096:Lrrk2 UTSW 15 91673256 start gained probably benign
R9097:Lrrk2 UTSW 15 91673256 start gained probably benign
R9267:Lrrk2 UTSW 15 91700426 missense probably damaging 0.99
R9285:Lrrk2 UTSW 15 91778483 missense probably damaging 1.00
R9341:Lrrk2 UTSW 15 91700415 missense probably benign 0.18
R9343:Lrrk2 UTSW 15 91700415 missense probably benign 0.18
R9371:Lrrk2 UTSW 15 91723204 missense probably damaging 1.00
R9424:Lrrk2 UTSW 15 91752185 nonsense probably null
R9489:Lrrk2 UTSW 15 91737217 missense probably benign 0.37
R9502:Lrrk2 UTSW 15 91723162 missense probably damaging 0.98
R9563:Lrrk2 UTSW 15 91749840 missense possibly damaging 0.90
R9576:Lrrk2 UTSW 15 91752185 nonsense probably null
R9605:Lrrk2 UTSW 15 91737217 missense probably benign 0.37
R9635:Lrrk2 UTSW 15 91812324 missense probably benign 0.21
R9641:Lrrk2 UTSW 15 91787048 missense possibly damaging 0.94
R9660:Lrrk2 UTSW 15 91734025 missense probably benign 0.00
R9673:Lrrk2 UTSW 15 91765681 missense probably damaging 1.00
R9708:Lrrk2 UTSW 15 91750279 nonsense probably null
R9728:Lrrk2 UTSW 15 91734025 missense probably benign 0.00
R9757:Lrrk2 UTSW 15 91811026 missense probably benign 0.03
RF001:Lrrk2 UTSW 15 91736633 missense probably benign 0.11
X0028:Lrrk2 UTSW 15 91738851 missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91726240 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GGCTTACAGGCTTCTGAAGAAAC -3'
(R):5'- AGCTAGCCCCATCTACATATCTG -3'

Sequencing Primer
(F):5'- GTTGGACACACTTGAATCTAACCTC -3'
(R):5'- GCCCCATCTACATATCTGAATTTTTC -3'
Posted On 2016-12-15