Incidental Mutation 'R5782:Brwd1'
ID447830
Institutional Source Beutler Lab
Gene Symbol Brwd1
Ensembl Gene ENSMUSG00000022914
Gene Namebromodomain and WD repeat domain containing 1
SynonymsG1-403-16, repro5, D530019K20Rik, 5330419I02Rik, Wdr9
MMRRC Submission 043379-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5782 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location95992092-96082428 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 96043043 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 770 (Y770*)
Ref Sequence ENSEMBL: ENSMUSP00000117066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023631] [ENSMUST00000099502] [ENSMUST00000113829] [ENSMUST00000124370] [ENSMUST00000131322] [ENSMUST00000153398]
Predicted Effect probably null
Transcript: ENSMUST00000023631
AA Change: Y770*
SMART Domains Protein: ENSMUSP00000023631
Gene: ENSMUSG00000022914
AA Change: Y770*

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099502
AA Change: Y770*
SMART Domains Protein: ENSMUSP00000097101
Gene: ENSMUSG00000022914
AA Change: Y770*

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113829
AA Change: Y770*
SMART Domains Protein: ENSMUSP00000109460
Gene: ENSMUSG00000022914
AA Change: Y770*

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.13e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.13e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2177 2188 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124370
AA Change: Y493*
SMART Domains Protein: ENSMUSP00000118423
Gene: ENSMUSG00000022914
AA Change: Y493*

DomainStartEndE-ValueType
WD40 34 75 3.82e1 SMART
WD40 80 119 4.27e-8 SMART
WD40 140 177 8.59e-1 SMART
WD40 180 220 1.47e-6 SMART
WD40 227 267 9.21e0 SMART
low complexity region 383 399 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
low complexity region 531 547 N/A INTRINSIC
low complexity region 585 602 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126629
Predicted Effect probably null
Transcript: ENSMUST00000131322
AA Change: Y217*
SMART Domains Protein: ENSMUSP00000118327
Gene: ENSMUSG00000022914
AA Change: Y217*

DomainStartEndE-ValueType
low complexity region 107 123 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 353 374 N/A INTRINSIC
Blast:BROMO 496 582 4e-37 BLAST
Blast:BROMO 603 627 5e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146222
Predicted Effect probably null
Transcript: ENSMUST00000153398
AA Change: Y770*
SMART Domains Protein: ENSMUSP00000117066
Gene: ENSMUSG00000022914
AA Change: Y770*

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
internal_repeat_1 1491 1957 1.45e-251 PROSPERO
internal_repeat_1 1956 2422 1.45e-251 PROSPERO
low complexity region 2630 2639 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184285
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) residues which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 2 bromodomains and multiple WD repeats. This gene is located within the Down syndrome region-2 on chromosome 21. Alternative splicing of this gene generates multiple transcript variants encoding distinct isoforms. In mouse, this gene encodes a nuclear protein that has a polyglutamine-containing region that functions as a transcriptional activation domain which may regulate chromatin remodelling and associates with a component of the SWI/SNF chromatin remodelling complex.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous males and females are infertile. Spermiogenesis is impaired; males have low epididymal sperm concentration with low motility and abnormal sperm head morphology. Female oocytes commonly contain vacuoles and have low developmental competence to 2-cell and blastocyst stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,903 I81M probably benign Het
2810403A07Rik T G 3: 88,711,678 V563G probably damaging Het
9130011E15Rik A G 19: 45,886,027 V569A probably benign Het
Actl9 A T 17: 33,433,761 Q265L probably benign Het
Adamtsl3 T A 7: 82,540,286 probably null Het
Agt A T 8: 124,557,131 probably null Het
Ankrd11 A G 8: 122,900,017 L142P probably damaging Het
Arhgef19 C A 4: 141,256,312 Q719K probably damaging Het
Atrnl1 G T 19: 57,753,286 W1159L possibly damaging Het
Atxn2 T C 5: 121,797,310 Y325H probably damaging Het
Cdc20 T C 4: 118,433,042 E474G probably benign Het
Cdk5rap3 A G 11: 96,911,586 L254P probably benign Het
Cep83 A T 10: 94,749,032 N333I probably damaging Het
Cox4i2 A C 2: 152,764,811 D150A probably damaging Het
Cse1l A G 2: 166,929,001 I314M probably damaging Het
Cuedc1 A G 11: 88,170,032 Y67C probably damaging Het
Cyp2j9 C T 4: 96,573,905 V380I probably benign Het
D3Ertd254e T C 3: 36,164,979 S384P possibly damaging Het
Fancd2 A G 6: 113,548,872 N302S probably benign Het
Foxa1 T A 12: 57,542,516 H306L probably benign Het
Gm21994 T C 2: 150,255,518 E25G probably benign Het
Gse1 T C 8: 120,566,521 S204P probably damaging Het
Hspa13 C A 16: 75,758,097 R367L probably damaging Het
Kcnk2 T G 1: 189,256,579 D267A probably damaging Het
Kctd18 A G 1: 57,959,237 Y68H probably damaging Het
Klf7 C T 1: 64,042,411 E253K possibly damaging Het
Lcn12 A T 2: 25,493,757 F34I probably damaging Het
Lrrk2 A T 15: 91,702,183 R401W probably damaging Het
Lzts1 A T 8: 69,140,698 S86T probably benign Het
Mtus1 T A 8: 41,082,727 I651F probably damaging Het
Myl2 T A 5: 122,104,870 F106L probably damaging Het
Neb T A 2: 52,264,047 K2351* probably null Het
Olfr297 T A 7: 86,527,213 I152N probably damaging Het
Olfr678 T C 7: 105,069,749 I94T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Parg A T 14: 32,274,905 R318* probably null Het
Pcdhga3 C T 18: 37,676,300 S602F possibly damaging Het
Pcnx2 A G 8: 125,753,484 V2028A probably damaging Het
Pkhd1 T C 1: 20,058,600 T3960A probably benign Het
Psen1 T A 12: 83,712,459 H81Q possibly damaging Het
Psma6 A G 12: 55,410,256 N109S possibly damaging Het
Ptpro A T 6: 137,399,498 I659F possibly damaging Het
Rap1gds1 C G 3: 138,959,079 E288D possibly damaging Het
Reln C T 5: 22,018,056 R993K probably benign Het
Saxo1 T A 4: 86,445,807 L146F probably damaging Het
Six4 A G 12: 73,104,058 V571A probably benign Het
Slc2a10 C A 2: 165,514,838 Y139* probably null Het
Slc34a1 A G 13: 55,402,688 I66V possibly damaging Het
Slfn8 G T 11: 83,017,041 N46K probably damaging Het
Smc6 G C 12: 11,290,834 A496P probably damaging Het
Stk31 T G 6: 49,469,136 N902K probably benign Het
Stk36 T A 1: 74,605,425 Y114N possibly damaging Het
Sult2b1 C T 7: 45,731,346 V271M probably damaging Het
Tenm4 A G 7: 96,893,039 I1920V probably benign Het
Trbc2 A G 6: 41,546,937 probably benign Het
Trpc2 A G 7: 102,083,979 D419G possibly damaging Het
Trpm7 T C 2: 126,797,714 N1654S probably benign Het
Tsku A T 7: 98,352,850 D91E probably damaging Het
Ttn T A 2: 76,776,011 R18151S probably damaging Het
Tyr C T 7: 87,493,016 C112Y probably damaging Het
Ubash3a G A 17: 31,235,503 G435S probably benign Het
Vav1 T C 17: 57,296,001 I51T probably damaging Het
Vmn2r61 T A 7: 42,299,829 C558S probably damaging Het
Zan C T 5: 137,420,007 C2943Y unknown Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp575 C A 7: 24,585,602 G205C possibly damaging Het
Zfp740 G T 15: 102,208,366 probably benign Het
Zzz3 A G 3: 152,428,100 E265G possibly damaging Het
Other mutations in Brwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Brwd1 APN 16 96017586 missense probably damaging 1.00
IGL00974:Brwd1 APN 16 96043026 missense probably damaging 1.00
IGL01014:Brwd1 APN 16 96016173 missense probably benign 0.04
IGL01447:Brwd1 APN 16 96047379 nonsense probably null
IGL01459:Brwd1 APN 16 96047420 missense probably damaging 1.00
IGL01631:Brwd1 APN 16 96046466 missense probably damaging 1.00
IGL02184:Brwd1 APN 16 96013829 missense probably damaging 1.00
IGL02264:Brwd1 APN 16 96019456 missense probably damaging 0.98
IGL02679:Brwd1 APN 16 96002823 missense probably benign
IGL02833:Brwd1 APN 16 96052571 missense probably damaging 1.00
IGL02960:Brwd1 APN 16 96057466 missense probably damaging 1.00
IGL03053:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03074:Brwd1 APN 16 96011850 missense probably benign 0.00
IGL03135:Brwd1 APN 16 96021258 missense probably damaging 0.99
IGL03168:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03214:Brwd1 APN 16 96037900 missense probably benign 0.26
IGL03328:Brwd1 APN 16 96002725 missense probably damaging 0.99
bromide UTSW 16 96064887 missense probably damaging 1.00
Embers UTSW 16 96017604 missense probably damaging 1.00
Glowing UTSW 16 96035959 missense probably damaging 1.00
Soporific UTSW 16 96033843 nonsense probably null
G1citation:Brwd1 UTSW 16 96041274 missense probably benign 0.42
PIT4243001:Brwd1 UTSW 16 96002671 nonsense probably null
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0030:Brwd1 UTSW 16 96021256 missense probably damaging 1.00
R0135:Brwd1 UTSW 16 96047104 missense probably damaging 1.00
R0366:Brwd1 UTSW 16 96037964 nonsense probably null
R0551:Brwd1 UTSW 16 96035974 missense probably damaging 1.00
R0586:Brwd1 UTSW 16 96043086 missense probably damaging 1.00
R0865:Brwd1 UTSW 16 96068584 missense probably damaging 1.00
R1226:Brwd1 UTSW 16 96031548 missense probably benign 0.35
R1329:Brwd1 UTSW 16 96003234 missense probably benign 0.07
R1378:Brwd1 UTSW 16 96041370 missense probably benign 0.06
R1420:Brwd1 UTSW 16 96036034 missense probably damaging 1.00
R1441:Brwd1 UTSW 16 96066151 missense probably damaging 0.99
R1484:Brwd1 UTSW 16 96028291 splice site probably null
R1624:Brwd1 UTSW 16 96008144 missense possibly damaging 0.67
R1636:Brwd1 UTSW 16 96059641 missense probably damaging 1.00
R1988:Brwd1 UTSW 16 96021237 missense probably damaging 0.96
R1998:Brwd1 UTSW 16 96021288 missense probably damaging 1.00
R2066:Brwd1 UTSW 16 96046465 missense probably benign 0.01
R2898:Brwd1 UTSW 16 96066100 missense probably damaging 0.99
R2983:Brwd1 UTSW 16 96066574 missense probably damaging 0.98
R3966:Brwd1 UTSW 16 96044530 missense probably damaging 1.00
R4086:Brwd1 UTSW 16 96046372 missense probably benign 0.03
R4257:Brwd1 UTSW 16 96023496 missense probably damaging 1.00
R4290:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4292:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4293:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4614:Brwd1 UTSW 16 96047359 missense probably damaging 1.00
R4771:Brwd1 UTSW 16 96003318 missense probably benign 0.00
R5025:Brwd1 UTSW 16 96053972 missense probably damaging 0.97
R5155:Brwd1 UTSW 16 96002793 nonsense probably null
R5229:Brwd1 UTSW 16 96002209 missense possibly damaging 0.87
R5246:Brwd1 UTSW 16 96002557 missense probably damaging 1.00
R5668:Brwd1 UTSW 16 96016150 missense probably damaging 1.00
R5763:Brwd1 UTSW 16 96033843 nonsense probably null
R5831:Brwd1 UTSW 16 96019436 missense probably damaging 1.00
R5836:Brwd1 UTSW 16 96064758 missense probably damaging 1.00
R5906:Brwd1 UTSW 16 96058738 missense probably damaging 1.00
R5995:Brwd1 UTSW 16 96064787 missense probably damaging 1.00
R6143:Brwd1 UTSW 16 96002956 missense probably benign 0.00
R6241:Brwd1 UTSW 16 96013874 missense probably damaging 1.00
R6313:Brwd1 UTSW 16 96007941 missense probably benign 0.01
R6362:Brwd1 UTSW 16 96002307 missense probably damaging 1.00
R6551:Brwd1 UTSW 16 95993962 missense possibly damaging 0.55
R6736:Brwd1 UTSW 16 96068572 missense probably damaging 1.00
R6822:Brwd1 UTSW 16 96041274 missense probably benign 0.42
R7080:Brwd1 UTSW 16 96009530 missense probably benign 0.01
R7131:Brwd1 UTSW 16 96066498 missense probably damaging 1.00
R7208:Brwd1 UTSW 16 96035959 missense probably damaging 1.00
R7322:Brwd1 UTSW 16 96066119 missense probably damaging 1.00
R7483:Brwd1 UTSW 16 96056173 missense probably damaging 0.99
R7615:Brwd1 UTSW 16 96033839 missense probably damaging 0.96
R7621:Brwd1 UTSW 16 96064887 missense probably damaging 1.00
R7665:Brwd1 UTSW 16 96041343 missense probably benign 0.09
R7697:Brwd1 UTSW 16 96046401 missense probably benign 0.10
R7740:Brwd1 UTSW 16 96027368 missense probably damaging 1.00
R8120:Brwd1 UTSW 16 96019449 missense probably benign 0.23
R8187:Brwd1 UTSW 16 96002734 missense probably damaging 0.98
R8359:Brwd1 UTSW 16 96016209 missense probably damaging 1.00
R8480:Brwd1 UTSW 16 96047430 missense probably damaging 0.98
R8511:Brwd1 UTSW 16 96058738 missense probably damaging 1.00
X0017:Brwd1 UTSW 16 96044491 missense probably damaging 1.00
X0028:Brwd1 UTSW 16 96011923 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGCTTTAAATGCCCAACAAAAG -3'
(R):5'- AGTCTTGACCGTGATGAGGC -3'

Sequencing Primer
(F):5'- TGCCCAACAAAAGACTTTAAGC -3'
(R):5'- GCTGAAGCGTCTTCTCATTTCAATAG -3'
Posted On2016-12-15