Incidental Mutation 'R5783:Ppp2r5a'
ID447839
Institutional Source Beutler Lab
Gene Symbol Ppp2r5a
Ensembl Gene ENSMUSG00000026626
Gene Nameprotein phosphatase 2, regulatory subunit B', alpha
Synonyms
MMRRC Submission 043380-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R5783 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location191351975-191403272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 191354640 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 373 (Y373N)
Ref Sequence ENSEMBL: ENSMUSP00000070726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027940] [ENSMUST00000067976]
Predicted Effect probably benign
Transcript: ENSMUST00000027940
SMART Domains Protein: ENSMUSP00000027940
Gene: ENSMUSG00000026627

DomainStartEndE-ValueType
coiled coil region 2 36 N/A INTRINSIC
Pfam:TMEM206 55 349 7.2e-173 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000067976
AA Change: Y373N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070726
Gene: ENSMUSG00000026626
AA Change: Y373N

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:B56 56 462 3.6e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191920
Predicted Effect probably benign
Transcript: ENSMUST00000191925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195605
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B56 subfamily. Alternative transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,518,787 Y48F probably damaging Het
4930402H24Rik A C 2: 130,739,083 F582L possibly damaging Het
AI481877 A T 4: 59,076,239 L568* probably null Het
Apob A G 12: 8,001,022 D1082G probably damaging Het
Cald1 G A 6: 34,753,533 A236T possibly damaging Het
Ccdc88b A C 19: 6,853,916 C553G probably benign Het
Cenpe A G 3: 135,261,580 D2161G probably benign Het
Cep78 G T 19: 15,956,359 N618K probably benign Het
Chka A G 19: 3,864,661 N118D probably damaging Het
Dennd5a A C 7: 109,894,636 I1263S probably damaging Het
Dnm3 T C 1: 162,355,471 T92A possibly damaging Het
Dpp9 T C 17: 56,211,655 K50E probably damaging Het
Fen1 G T 19: 10,200,830 Y83* probably null Het
Gm1110 A G 9: 26,882,336 I532T probably benign Het
Hist2h2be T C 3: 96,221,299 V45A possibly damaging Het
Impdh1 A T 6: 29,206,343 F140Y possibly damaging Het
Kcnc4 T C 3: 107,447,872 D420G possibly damaging Het
Kctd19 A G 8: 105,386,980 V664A probably benign Het
Krt80 C T 15: 101,359,479 probably null Het
Lars2 T G 9: 123,461,596 M876R probably benign Het
Lrrc9 A G 12: 72,456,053 E266G possibly damaging Het
Mesd T A 7: 83,895,675 V120E probably damaging Het
Mogs C T 6: 83,118,671 T823I probably damaging Het
Mrgprh C A 17: 12,877,446 T191N probably benign Het
Mtss1 C T 15: 58,943,524 S729N probably benign Het
Muc5b G T 7: 141,858,428 E1704* probably null Het
Olfr1076 T C 2: 86,508,638 Y60H probably damaging Het
Olfr631 A T 7: 103,928,942 I40F probably damaging Het
Olfr695 C A 7: 106,873,334 V304F probably damaging Het
Osbpl8 T A 10: 111,267,783 L216* probably null Het
Pcdha5 T C 18: 36,962,481 V681A probably benign Het
Pgap3 A C 11: 98,390,464 V190G probably benign Het
Prkdc T C 16: 15,717,801 L1675P probably damaging Het
Rapgef2 T G 3: 79,087,993 I635L probably benign Het
Rusc1 T C 3: 89,088,145 D193G probably damaging Het
Ryr3 C T 2: 112,652,998 V4140I probably benign Het
Scamp5 A G 9: 57,446,070 probably null Het
Slc41a3 T C 6: 90,619,542 I31T probably benign Het
Smad9 T C 3: 54,794,442 V368A probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
St8sia1 T C 6: 142,963,614 N52S possibly damaging Het
Svop T G 5: 114,064,935 D72A possibly damaging Het
Sybu T C 15: 44,746,414 I153V probably damaging Het
Tmem266 G T 9: 55,397,803 S32I probably damaging Het
Trpm4 G T 7: 45,310,389 R694S probably benign Het
Uqcrfs1 A G 13: 30,545,204 L15P probably damaging Het
Vrtn T A 12: 84,650,477 L667Q probably benign Het
Zc3h14 T A 12: 98,757,175 S241R probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp617 C A 8: 71,932,464 H213N probably damaging Het
Zfp638 G A 6: 83,944,847 G652D possibly damaging Het
Zmiz2 T C 11: 6,405,081 L916P probably damaging Het
Other mutations in Ppp2r5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03297:Ppp2r5a APN 1 191354762 missense probably benign 0.28
R1640:Ppp2r5a UTSW 1 191353929 missense probably damaging 0.99
R3005:Ppp2r5a UTSW 1 191358976 missense probably damaging 1.00
R4810:Ppp2r5a UTSW 1 191356392 unclassified probably benign
R5730:Ppp2r5a UTSW 1 191372535 missense probably benign 0.04
R5769:Ppp2r5a UTSW 1 191372666 missense probably benign 0.02
R6215:Ppp2r5a UTSW 1 191362250 missense probably benign 0.02
R7311:Ppp2r5a UTSW 1 191357801 missense probably damaging 1.00
R7485:Ppp2r5a UTSW 1 191396335 missense probably benign 0.07
R7545:Ppp2r5a UTSW 1 191372609 missense probably benign 0.00
V5622:Ppp2r5a UTSW 1 191358992 missense probably damaging 1.00
V5622:Ppp2r5a UTSW 1 191359001 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCTGTCCAGGCTTCAACTAGC -3'
(R):5'- ACCGATTTGCCTTGTCTACATTAG -3'

Sequencing Primer
(F):5'- GCCAAGAGTTCAAGGCTAGCC -3'
(R):5'- GATCTTAGATGTCATTGAACCAACAC -3'
Posted On2016-12-15