Incidental Mutation 'R0545:Washc5'
ID 44784
Institutional Source Beutler Lab
Gene Symbol Washc5
Ensembl Gene ENSMUSG00000022350
Gene Name WASH complex subunit 5
Synonyms strumpellin, E430025E21Rik
MMRRC Submission 038737-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # R0545 (G1)
Quality Score 174
Status Validated
Chromosome 15
Chromosomal Location 59203846-59246016 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 59213942 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 838 (C838Y)
Ref Sequence ENSEMBL: ENSMUSP00000022976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022976] [ENSMUST00000227725]
AlphaFold Q8C2E7
Predicted Effect possibly damaging
Transcript: ENSMUST00000022976
AA Change: C838Y

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022976
Gene: ENSMUSG00000022350
AA Change: C838Y

DomainStartEndE-ValueType
Pfam:Strumpellin 23 1103 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227725
AA Change: C388Y

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.3140 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 134 kDa protein named strumpellin that is predicted to have multiple transmembrane domains and a spectrin-repeat-containing domain. This ubiquitously expressed gene has its highest expression in skeletal muscle. The protein is named for Strumpell disease; a form of hereditary spastic paraplegia (HSP). Spastic paraplegias are a diverse group of disorders in which the autosomal dominant forms are characterized by progressive, lower extremity spasticity caused by axonal degeneration in the terminal portions of the longest descending and ascending corticospinal tracts. More than 30 loci (SPG1-33) have been implicated in hereditary spastic paraplegia diseases. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal coat color and melanocyte stem cells but enlarged, clustered WASH- and WAFL-positive vesicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,547,187 (GRCm39) R76H probably damaging Het
Adnp2 T C 18: 80,172,616 (GRCm39) I598V probably benign Het
Ago3 T C 4: 126,311,025 (GRCm39) N63D probably damaging Het
Alkbh7 C T 17: 57,306,012 (GRCm39) R138* probably null Het
Atp6ap1l T C 13: 91,031,782 (GRCm39) H300R probably benign Het
BC051076 C T 5: 88,111,349 (GRCm39) noncoding transcript Het
Bltp1 G A 3: 37,041,839 (GRCm39) probably benign Het
Bpifb9a T A 2: 154,103,870 (GRCm39) C104* probably null Het
Cacna2d2 T C 9: 107,402,422 (GRCm39) L826P probably damaging Het
Car5b G A X: 162,762,297 (GRCm39) R282C probably damaging Het
Ccdc88c T C 12: 100,913,447 (GRCm39) D526G probably damaging Het
Cdh23 T A 10: 60,167,070 (GRCm39) T1861S probably benign Het
Ces2f A C 8: 105,676,668 (GRCm39) M121L possibly damaging Het
Cfap58 G A 19: 47,929,536 (GRCm39) probably benign Het
Chpf2 T C 5: 24,795,322 (GRCm39) S282P possibly damaging Het
Cluap1 C T 16: 3,751,636 (GRCm39) R332W probably damaging Het
Cma2 A T 14: 56,210,570 (GRCm39) M86L probably benign Het
Cog6 A T 3: 52,903,496 (GRCm39) M134K probably damaging Het
Col1a1 A G 11: 94,842,420 (GRCm39) D1446G unknown Het
Cpne8 T A 15: 90,381,278 (GRCm39) D512V probably damaging Het
Ctnna2 T A 6: 77,582,165 (GRCm39) N352I probably damaging Het
Cyp2c69 A C 19: 39,875,105 (GRCm39) L16R probably damaging Het
Dysf T C 6: 84,076,443 (GRCm39) S603P probably damaging Het
Epha5 A G 5: 84,215,217 (GRCm39) probably null Het
Ercc3 T C 18: 32,378,955 (GRCm39) S270P probably damaging Het
F10 T A 8: 13,098,249 (GRCm39) C151S probably damaging Het
Gpr180 T G 14: 118,397,458 (GRCm39) H317Q possibly damaging Het
Gstp2 T C 19: 4,091,633 (GRCm39) E32G possibly damaging Het
Ikzf5 T C 7: 130,994,229 (GRCm39) T133A possibly damaging Het
Itch G T 2: 155,024,218 (GRCm39) G274* probably null Het
Jarid2 T A 13: 45,056,307 (GRCm39) N365K probably benign Het
Lama3 T A 18: 12,694,758 (GRCm39) S1295T possibly damaging Het
Lipc A G 9: 70,719,987 (GRCm39) L255P probably damaging Het
Lrrc38 A G 4: 143,077,328 (GRCm39) D197G probably benign Het
Mfap2 A G 4: 140,741,496 (GRCm39) probably benign Het
Mfhas1 A G 8: 36,056,202 (GRCm39) K226E probably damaging Het
Morc1 A G 16: 48,386,020 (GRCm39) R548G probably benign Het
Mrgprb5 T C 7: 47,818,633 (GRCm39) N34S probably benign Het
Mroh4 T C 15: 74,497,276 (GRCm39) T182A probably benign Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Myo5a T C 9: 75,074,319 (GRCm39) F743L possibly damaging Het
Notch4 A C 17: 34,802,407 (GRCm39) D1276A probably damaging Het
Or1e34 A T 11: 73,778,843 (GRCm39) Y118* probably null Het
Or3a10 A G 11: 73,935,873 (GRCm39) C76R possibly damaging Het
Or6c209 T A 10: 129,483,218 (GRCm39) C74S probably damaging Het
Or6d15 T A 6: 116,559,617 (GRCm39) I97L probably benign Het
Plin4 T A 17: 56,413,567 (GRCm39) T353S probably damaging Het
Ppp1r9a A G 6: 5,115,357 (GRCm39) T827A probably benign Het
Prlr C T 15: 10,317,652 (GRCm39) T40I probably damaging Het
Psme3 T C 11: 101,210,730 (GRCm39) probably benign Het
Pygb A T 2: 150,657,626 (GRCm39) D363V probably benign Het
Rsph6a C T 7: 18,788,871 (GRCm39) Q68* probably null Het
Serpini2 A G 3: 75,165,445 (GRCm39) V178A probably benign Het
Sh2d2a T C 3: 87,759,195 (GRCm39) probably benign Het
Skint7 A C 4: 111,837,395 (GRCm39) M58L probably benign Het
Slco3a1 G T 7: 73,970,301 (GRCm39) Y435* probably null Het
Stk17b T C 1: 53,801,742 (GRCm39) probably benign Het
Tinag T A 9: 76,938,992 (GRCm39) H162L possibly damaging Het
Ttc21a T A 9: 119,787,865 (GRCm39) L811Q probably damaging Het
Ttc41 A T 10: 86,594,961 (GRCm39) M912L probably benign Het
Vmn2r98 G T 17: 19,273,875 (GRCm39) V41F probably benign Het
Wrnip1 A G 13: 32,990,796 (GRCm39) T352A probably damaging Het
Zan A C 5: 137,394,439 (GRCm39) C4467G unknown Het
Zc3h7a T C 16: 10,970,197 (GRCm39) probably benign Het
Zfp729a C A 13: 67,768,345 (GRCm39) C628F probably benign Het
Other mutations in Washc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Washc5 APN 15 59,209,125 (GRCm39) missense probably damaging 0.99
IGL01096:Washc5 APN 15 59,222,060 (GRCm39) splice site probably benign
IGL01305:Washc5 APN 15 59,227,688 (GRCm39) nonsense probably null
IGL01707:Washc5 APN 15 59,213,864 (GRCm39) missense possibly damaging 0.89
IGL01921:Washc5 APN 15 59,213,958 (GRCm39) splice site probably null
IGL02056:Washc5 APN 15 59,222,185 (GRCm39) missense possibly damaging 0.63
IGL02145:Washc5 APN 15 59,241,060 (GRCm39) missense probably benign
IGL02430:Washc5 APN 15 59,238,140 (GRCm39) missense probably damaging 1.00
IGL02450:Washc5 APN 15 59,204,166 (GRCm39) nonsense probably null
IGL03238:Washc5 APN 15 59,218,691 (GRCm39) missense probably damaging 1.00
IGL03351:Washc5 APN 15 59,235,199 (GRCm39) splice site probably benign
ANU22:Washc5 UTSW 15 59,227,688 (GRCm39) nonsense probably null
R0004:Washc5 UTSW 15 59,239,316 (GRCm39) missense probably damaging 1.00
R0004:Washc5 UTSW 15 59,239,316 (GRCm39) missense probably damaging 1.00
R0100:Washc5 UTSW 15 59,215,947 (GRCm39) missense possibly damaging 0.83
R0100:Washc5 UTSW 15 59,215,947 (GRCm39) missense possibly damaging 0.83
R0179:Washc5 UTSW 15 59,224,379 (GRCm39) missense probably benign 0.01
R0265:Washc5 UTSW 15 59,210,809 (GRCm39) missense probably benign 0.43
R0315:Washc5 UTSW 15 59,213,825 (GRCm39) missense probably damaging 1.00
R0611:Washc5 UTSW 15 59,213,007 (GRCm39) missense probably damaging 0.99
R0636:Washc5 UTSW 15 59,231,258 (GRCm39) missense probably benign 0.01
R1006:Washc5 UTSW 15 59,241,036 (GRCm39) missense probably benign 0.06
R1006:Washc5 UTSW 15 59,241,035 (GRCm39) missense probably benign 0.21
R1237:Washc5 UTSW 15 59,210,757 (GRCm39) splice site probably benign
R1835:Washc5 UTSW 15 59,231,189 (GRCm39) missense possibly damaging 0.86
R1888:Washc5 UTSW 15 59,231,174 (GRCm39) missense probably damaging 0.99
R1888:Washc5 UTSW 15 59,231,174 (GRCm39) missense probably damaging 0.99
R2005:Washc5 UTSW 15 59,213,004 (GRCm39) missense possibly damaging 0.89
R2006:Washc5 UTSW 15 59,213,004 (GRCm39) missense possibly damaging 0.89
R2060:Washc5 UTSW 15 59,222,257 (GRCm39) missense probably damaging 1.00
R2134:Washc5 UTSW 15 59,241,083 (GRCm39) missense probably damaging 1.00
R2139:Washc5 UTSW 15 59,221,991 (GRCm39) missense probably damaging 1.00
R2177:Washc5 UTSW 15 59,235,118 (GRCm39) nonsense probably null
R2975:Washc5 UTSW 15 59,217,207 (GRCm39) missense probably damaging 1.00
R4088:Washc5 UTSW 15 59,211,711 (GRCm39) missense probably damaging 1.00
R4824:Washc5 UTSW 15 59,205,485 (GRCm39) nonsense probably null
R4843:Washc5 UTSW 15 59,222,220 (GRCm39) missense possibly damaging 0.95
R4991:Washc5 UTSW 15 59,215,929 (GRCm39) missense probably damaging 1.00
R4996:Washc5 UTSW 15 59,205,484 (GRCm39) missense probably benign
R5103:Washc5 UTSW 15 59,222,018 (GRCm39) missense probably damaging 1.00
R5312:Washc5 UTSW 15 59,217,377 (GRCm39) splice site probably null
R5591:Washc5 UTSW 15 59,241,012 (GRCm39) missense probably damaging 1.00
R6073:Washc5 UTSW 15 59,207,019 (GRCm39) missense possibly damaging 0.90
R6123:Washc5 UTSW 15 59,206,959 (GRCm39) missense probably damaging 1.00
R6156:Washc5 UTSW 15 59,217,248 (GRCm39) missense probably damaging 1.00
R6292:Washc5 UTSW 15 59,227,783 (GRCm39) missense probably damaging 1.00
R6297:Washc5 UTSW 15 59,215,895 (GRCm39) missense possibly damaging 0.61
R6374:Washc5 UTSW 15 59,209,044 (GRCm39) missense probably benign 0.14
R6659:Washc5 UTSW 15 59,212,739 (GRCm39) critical splice donor site probably null
R6880:Washc5 UTSW 15 59,222,021 (GRCm39) missense probably benign 0.00
R7146:Washc5 UTSW 15 59,224,350 (GRCm39) nonsense probably null
R7330:Washc5 UTSW 15 59,205,516 (GRCm39) missense probably benign 0.02
R7430:Washc5 UTSW 15 59,241,762 (GRCm39) nonsense probably null
R7490:Washc5 UTSW 15 59,209,053 (GRCm39) missense probably benign 0.18
R7532:Washc5 UTSW 15 59,239,260 (GRCm39) missense possibly damaging 0.46
R7560:Washc5 UTSW 15 59,238,041 (GRCm39) missense probably damaging 0.97
R7803:Washc5 UTSW 15 59,240,308 (GRCm39) missense probably damaging 0.98
R8242:Washc5 UTSW 15 59,215,971 (GRCm39) missense probably damaging 1.00
R8841:Washc5 UTSW 15 59,206,971 (GRCm39) missense probably damaging 1.00
R9022:Washc5 UTSW 15 59,233,069 (GRCm39) missense probably damaging 1.00
R9022:Washc5 UTSW 15 59,217,233 (GRCm39) missense possibly damaging 0.95
R9123:Washc5 UTSW 15 59,209,134 (GRCm39) missense probably damaging 1.00
R9125:Washc5 UTSW 15 59,209,134 (GRCm39) missense probably damaging 1.00
R9310:Washc5 UTSW 15 59,218,067 (GRCm39) missense possibly damaging 0.89
R9423:Washc5 UTSW 15 59,227,735 (GRCm39) missense probably benign
R9556:Washc5 UTSW 15 59,218,716 (GRCm39) missense possibly damaging 0.95
R9569:Washc5 UTSW 15 59,215,980 (GRCm39) missense probably benign
R9668:Washc5 UTSW 15 59,218,062 (GRCm39) critical splice donor site probably null
R9691:Washc5 UTSW 15 59,218,706 (GRCm39) missense probably damaging 1.00
R9718:Washc5 UTSW 15 59,217,192 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGAGGTGAGACCTGCTATTCTTCCC -3'
(R):5'- AGCAGTGCTATTCCCCTGCAATC -3'

Sequencing Primer
(F):5'- cgtccattgctatctgcttc -3'
(R):5'- tgcaatcctagcatcaggag -3'
Posted On 2013-06-11