Incidental Mutation 'R0545:Washc5'
Institutional Source Beutler Lab
Gene Symbol Washc5
Ensembl Gene ENSMUSG00000022350
Gene NameWASH complex subunit 5
SynonymsE430025E21Rik, strumpellin
MMRRC Submission 038737-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R0545 (G1)
Quality Score174
Status Validated
Chromosomal Location59331997-59374167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59342093 bp
Amino Acid Change Cysteine to Tyrosine at position 838 (C838Y)
Ref Sequence ENSEMBL: ENSMUSP00000022976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022976] [ENSMUST00000227725]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022976
AA Change: C838Y

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022976
Gene: ENSMUSG00000022350
AA Change: C838Y

Pfam:Strumpellin 23 1103 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227725
AA Change: C388Y

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.3140 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 134 kDa protein named strumpellin that is predicted to have multiple transmembrane domains and a spectrin-repeat-containing domain. This ubiquitously expressed gene has its highest expression in skeletal muscle. The protein is named for Strumpell disease; a form of hereditary spastic paraplegia (HSP). Spastic paraplegias are a diverse group of disorders in which the autosomal dominant forms are characterized by progressive, lower extremity spasticity caused by axonal degeneration in the terminal portions of the longest descending and ascending corticospinal tracts. More than 30 loci (SPG1-33) have been implicated in hereditary spastic paraplegia diseases. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal coat color and melanocyte stem cells but enlarged, clustered WASH- and WAFL-positive vesicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,542,376 R76H probably damaging Het
4932438A13Rik G A 3: 36,987,690 probably benign Het
Adnp2 T C 18: 80,129,401 I598V probably benign Het
Ago3 T C 4: 126,417,232 N63D probably damaging Het
Alkbh7 C T 17: 56,999,012 R138* probably null Het
Atp6ap1l T C 13: 90,883,663 H300R probably benign Het
BC051076 C T 5: 87,963,490 noncoding transcript Het
Bpifb9a T A 2: 154,261,950 C104* probably null Het
Cacna2d2 T C 9: 107,525,223 L826P probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Ccdc88c T C 12: 100,947,188 D526G probably damaging Het
Cdh23 T A 10: 60,331,291 T1861S probably benign Het
Ces2f A C 8: 104,950,036 M121L possibly damaging Het
Cfap58 G A 19: 47,941,097 probably benign Het
Chpf2 T C 5: 24,590,324 S282P possibly damaging Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Cma2 A T 14: 55,973,113 M86L probably benign Het
Cog6 A T 3: 52,996,075 M134K probably damaging Het
Col1a1 A G 11: 94,951,594 D1446G unknown Het
Cpne8 T A 15: 90,497,075 D512V probably damaging Het
Ctnna2 T A 6: 77,605,182 N352I probably damaging Het
Cyp2c69 A C 19: 39,886,661 L16R probably damaging Het
Dysf T C 6: 84,099,461 S603P probably damaging Het
Epha5 A G 5: 84,067,358 probably null Het
Ercc3 T C 18: 32,245,902 S270P probably damaging Het
F10 T A 8: 13,048,249 C151S probably damaging Het
Gpr180 T G 14: 118,160,046 H317Q possibly damaging Het
Gstp2 T C 19: 4,041,633 E32G possibly damaging Het
Ikzf5 T C 7: 131,392,500 T133A possibly damaging Het
Itch G T 2: 155,182,298 G274* probably null Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Lama3 T A 18: 12,561,701 S1295T possibly damaging Het
Lipc A G 9: 70,812,705 L255P probably damaging Het
Lrrc38 A G 4: 143,350,758 D197G probably benign Het
Mfap2 A G 4: 141,014,185 probably benign Het
Mfhas1 A G 8: 35,589,048 K226E probably damaging Het
Morc1 A G 16: 48,565,657 R548G probably benign Het
Mrgprb5 T C 7: 48,168,885 N34S probably benign Het
Mroh4 T C 15: 74,625,427 T182A probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo5a T C 9: 75,167,037 F743L possibly damaging Het
Notch4 A C 17: 34,583,433 D1276A probably damaging Het
Olfr139 A G 11: 74,045,047 C76R possibly damaging Het
Olfr215 T A 6: 116,582,656 I97L probably benign Het
Olfr394 A T 11: 73,888,017 Y118* probably null Het
Olfr799 T A 10: 129,647,349 C74S probably damaging Het
Plin4 T A 17: 56,106,567 T353S probably damaging Het
Ppp1r9a A G 6: 5,115,357 T827A probably benign Het
Prlr C T 15: 10,317,566 T40I probably damaging Het
Psme3 T C 11: 101,319,904 probably benign Het
Pygb A T 2: 150,815,706 D363V probably benign Het
Rsph6a C T 7: 19,054,946 Q68* probably null Het
Serpini2 A G 3: 75,258,138 V178A probably benign Het
Sh2d2a T C 3: 87,851,888 probably benign Het
Skint7 A C 4: 111,980,198 M58L probably benign Het
Slco3a1 G T 7: 74,320,553 Y435* probably null Het
Stk17b T C 1: 53,762,583 probably benign Het
Tinag T A 9: 77,031,710 H162L possibly damaging Het
Ttc21a T A 9: 119,958,799 L811Q probably damaging Het
Ttc41 A T 10: 86,759,097 M912L probably benign Het
Vmn2r98 G T 17: 19,053,613 V41F probably benign Het
Wrnip1 A G 13: 32,806,813 T352A probably damaging Het
Zan A C 5: 137,396,177 C4467G unknown Het
Zc3h7a T C 16: 11,152,333 probably benign Het
Zfp729a C A 13: 67,620,226 C628F probably benign Het
Other mutations in Washc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Washc5 APN 15 59337276 missense probably damaging 0.99
IGL01096:Washc5 APN 15 59350211 splice site probably benign
IGL01305:Washc5 APN 15 59355839 nonsense probably null
IGL01707:Washc5 APN 15 59342015 missense possibly damaging 0.89
IGL01921:Washc5 APN 15 59342109 splice site probably null
IGL02056:Washc5 APN 15 59350336 missense possibly damaging 0.63
IGL02145:Washc5 APN 15 59369211 missense probably benign
IGL02430:Washc5 APN 15 59366291 missense probably damaging 1.00
IGL02450:Washc5 APN 15 59332317 nonsense probably null
IGL03238:Washc5 APN 15 59346842 missense probably damaging 1.00
IGL03351:Washc5 APN 15 59363350 splice site probably benign
ANU22:Washc5 UTSW 15 59355839 nonsense probably null
R0004:Washc5 UTSW 15 59367467 missense probably damaging 1.00
R0004:Washc5 UTSW 15 59367467 missense probably damaging 1.00
R0100:Washc5 UTSW 15 59344098 missense possibly damaging 0.83
R0100:Washc5 UTSW 15 59344098 missense possibly damaging 0.83
R0179:Washc5 UTSW 15 59352530 missense probably benign 0.01
R0265:Washc5 UTSW 15 59338960 missense probably benign 0.43
R0315:Washc5 UTSW 15 59341976 missense probably damaging 1.00
R0611:Washc5 UTSW 15 59341158 missense probably damaging 0.99
R0636:Washc5 UTSW 15 59359409 missense probably benign 0.01
R1006:Washc5 UTSW 15 59369186 missense probably benign 0.21
R1006:Washc5 UTSW 15 59369187 missense probably benign 0.06
R1237:Washc5 UTSW 15 59338908 splice site probably benign
R1835:Washc5 UTSW 15 59359340 missense possibly damaging 0.86
R1888:Washc5 UTSW 15 59359325 missense probably damaging 0.99
R1888:Washc5 UTSW 15 59359325 missense probably damaging 0.99
R2005:Washc5 UTSW 15 59341155 missense possibly damaging 0.89
R2006:Washc5 UTSW 15 59341155 missense possibly damaging 0.89
R2060:Washc5 UTSW 15 59350408 missense probably damaging 1.00
R2134:Washc5 UTSW 15 59369234 missense probably damaging 1.00
R2139:Washc5 UTSW 15 59350142 missense probably damaging 1.00
R2177:Washc5 UTSW 15 59363269 nonsense probably null
R2975:Washc5 UTSW 15 59345358 missense probably damaging 1.00
R4088:Washc5 UTSW 15 59339862 missense probably damaging 1.00
R4824:Washc5 UTSW 15 59333636 nonsense probably null
R4843:Washc5 UTSW 15 59350371 missense possibly damaging 0.95
R4991:Washc5 UTSW 15 59344080 missense probably damaging 1.00
R4996:Washc5 UTSW 15 59333635 missense probably benign
R5103:Washc5 UTSW 15 59350169 missense probably damaging 1.00
R5312:Washc5 UTSW 15 59345528 splice site probably null
R5591:Washc5 UTSW 15 59369163 missense probably damaging 1.00
R6073:Washc5 UTSW 15 59335170 missense possibly damaging 0.90
R6123:Washc5 UTSW 15 59335110 missense probably damaging 1.00
R6156:Washc5 UTSW 15 59345399 missense probably damaging 1.00
R6292:Washc5 UTSW 15 59355934 missense probably damaging 1.00
R6297:Washc5 UTSW 15 59344046 missense possibly damaging 0.61
R6374:Washc5 UTSW 15 59337195 missense probably benign 0.14
R6659:Washc5 UTSW 15 59340890 critical splice donor site probably null
R6880:Washc5 UTSW 15 59350172 missense probably benign 0.00
R7146:Washc5 UTSW 15 59352501 nonsense probably null
R7330:Washc5 UTSW 15 59333667 missense probably benign 0.02
R7430:Washc5 UTSW 15 59369913 nonsense probably null
R7490:Washc5 UTSW 15 59337204 missense probably benign 0.18
R7532:Washc5 UTSW 15 59367411 missense possibly damaging 0.46
R7560:Washc5 UTSW 15 59366192 missense probably damaging 0.97
R7803:Washc5 UTSW 15 59368459 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cgtccattgctatctgcttc -3'
(R):5'- tgcaatcctagcatcaggag -3'
Posted On2013-06-11