Mutagenetix > Incidental Mutation

Incidental Mutation 'R5783:Olfr1076'

447841

Institutional Source

Beutler Lab

Gene Symbol

Olfr1076

Ensembl Gene

ENSMUSG00000060742

Gene Name

olfactory receptor 1076

Synonyms

GA_x6K02T2Q125-47993761-47994702, MOR189-2

MMRRC Submission

043380-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R5783 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86508461-86509402 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86508638 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 60 (Y60H)

Ref Sequence

ENSEMBL: ENSMUSP00000075612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076263]

AlphaFold

A2AK60

Predicted Effect

probably damaging
Transcript: ENSMUST00000076263
AA Change: Y60H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075612
Gene: ENSMUSG00000060742
AA Change: Y60H

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	306	4.6e-52	PFAM
Pfam:7tm_1	41	290	5e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217442

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	T	A	11: 23,518,787	Y48F	probably damaging	Het
4930402H24Rik	A	C	2: 130,739,083	F582L	possibly damaging	Het
AI481877	A	T	4: 59,076,239	L568*	probably null	Het
Apob	A	G	12: 8,001,022	D1082G	probably damaging	Het
Cald1	G	A	6: 34,753,533	A236T	possibly damaging	Het
Ccdc88b	A	C	19: 6,853,916	C553G	probably benign	Het
Cenpe	A	G	3: 135,261,580	D2161G	probably benign	Het
Cep78	G	T	19: 15,956,359	N618K	probably benign	Het
Chka	A	G	19: 3,864,661	N118D	probably damaging	Het
Dennd5a	A	C	7: 109,894,636	I1263S	probably damaging	Het
Dnm3	T	C	1: 162,355,471	T92A	possibly damaging	Het
Dpp9	T	C	17: 56,211,655	K50E	probably damaging	Het
Fen1	G	T	19: 10,200,830	Y83*	probably null	Het
Gm1110	A	G	9: 26,882,336	I532T	probably benign	Het
Hist2h2be	T	C	3: 96,221,299	V45A	possibly damaging	Het
Impdh1	A	T	6: 29,206,343	F140Y	possibly damaging	Het
Kcnc4	T	C	3: 107,447,872	D420G	possibly damaging	Het
Kctd19	A	G	8: 105,386,980	V664A	probably benign	Het
Krt80	C	T	15: 101,359,479		probably null	Het
Lars2	T	G	9: 123,461,596	M876R	probably benign	Het
Lrrc9	A	G	12: 72,456,053	E266G	possibly damaging	Het
Mesd	T	A	7: 83,895,675	V120E	probably damaging	Het
Mogs	C	T	6: 83,118,671	T823I	probably damaging	Het
Mrgprh	C	A	17: 12,877,446	T191N	probably benign	Het
Mtss1	C	T	15: 58,943,524	S729N	probably benign	Het
Muc5b	G	T	7: 141,858,428	E1704*	probably null	Het
Olfr631	A	T	7: 103,928,942	I40F	probably damaging	Het
Olfr695	C	A	7: 106,873,334	V304F	probably damaging	Het
Osbpl8	T	A	10: 111,267,783	L216*	probably null	Het
Pcdha5	T	C	18: 36,962,481	V681A	probably benign	Het
Pgap3	A	C	11: 98,390,464	V190G	probably benign	Het
Ppp2r5a	A	T	1: 191,354,640	Y373N	probably damaging	Het
Prkdc	T	C	16: 15,717,801	L1675P	probably damaging	Het
Rapgef2	T	G	3: 79,087,993	I635L	probably benign	Het
Rusc1	T	C	3: 89,088,145	D193G	probably damaging	Het
Ryr3	C	T	2: 112,652,998	V4140I	probably benign	Het
Scamp5	A	G	9: 57,446,070		probably null	Het
Slc41a3	T	C	6: 90,619,542	I31T	probably benign	Het
Smad9	T	C	3: 54,794,442	V368A	probably benign	Het
Smim8	TTTAATGAAGAGCT	TT	4: 34,771,261		probably benign	Het
St8sia1	T	C	6: 142,963,614	N52S	possibly damaging	Het
Svop	T	G	5: 114,064,935	D72A	possibly damaging	Het
Sybu	T	C	15: 44,746,414	I153V	probably damaging	Het
Tmem266	G	T	9: 55,397,803	S32I	probably damaging	Het
Trpm4	G	T	7: 45,310,389	R694S	probably benign	Het
Uqcrfs1	A	G	13: 30,545,204	L15P	probably damaging	Het
Vrtn	T	A	12: 84,650,477	L667Q	probably benign	Het
Zc3h14	T	A	12: 98,757,175	S241R	probably damaging	Het
Zfp318	TGAAGAAGAAGAAGAAGAAGAAGAAGAAG	TGAAGAAGAAGAAGAAGAAGAAG	17: 46,412,514		probably benign	Het
Zfp617	C	A	8: 71,932,464	H213N	probably damaging	Het
Zfp638	G	A	6: 83,944,847	G652D	possibly damaging	Het
Zmiz2	T	C	11: 6,405,081	L916P	probably damaging	Het

Other mutations in Olfr1076

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01291:Olfr1076	APN	2	86509169	missense	possibly damaging	0.91
IGL03157:Olfr1076	APN	2	86509023	missense	possibly damaging	0.95
ANU05:Olfr1076	UTSW	2	86509169	missense	possibly damaging	0.91
IGL02802:Olfr1076	UTSW	2	86508946	missense	probably benign
R0325:Olfr1076	UTSW	2	86509205	missense	probably benign	0.14
R0384:Olfr1076	UTSW	2	86509383	missense	possibly damaging	0.80
R1164:Olfr1076	UTSW	2	86508684	missense	probably damaging	1.00
R1618:Olfr1076	UTSW	2	86508849	missense	probably damaging	1.00
R1915:Olfr1076	UTSW	2	86508999	missense	probably damaging	1.00
R1999:Olfr1076	UTSW	2	86508745	nonsense	probably null
R2093:Olfr1076	UTSW	2	86509243	missense	probably damaging	0.99
R3824:Olfr1076	UTSW	2	86509023	missense	possibly damaging	0.95
R4259:Olfr1076	UTSW	2	86508999	missense	probably damaging	1.00
R4928:Olfr1076	UTSW	2	86509125	missense	probably damaging	1.00
R4981:Olfr1076	UTSW	2	86508827	missense	probably damaging	1.00
R4998:Olfr1076	UTSW	2	86509355	missense	probably benign	0.00
R6384:Olfr1076	UTSW	2	86509037	missense	probably benign
R6549:Olfr1076	UTSW	2	86509382	missense	probably benign	0.00
R6893:Olfr1076	UTSW	2	86508792	missense	probably damaging	1.00
R7145:Olfr1076	UTSW	2	86508528	missense	probably damaging	1.00
R7157:Olfr1076	UTSW	2	86509025	missense	probably damaging	0.99
R7555:Olfr1076	UTSW	2	86509347	missense	probably damaging	0.99
R7611:Olfr1076	UTSW	2	86509053	missense	possibly damaging	0.84
R7640:Olfr1076	UTSW	2	86508943	missense	possibly damaging	0.90
R7724:Olfr1076	UTSW	2	86508605	missense	probably damaging	1.00
R7965:Olfr1076	UTSW	2	86508471	missense	probably benign
R8367:Olfr1076	UTSW	2	86508681	missense	probably damaging	0.97
R9383:Olfr1076	UTSW	2	86508510	missense	probably damaging	0.97
R9432:Olfr1076	UTSW	2	86508570	missense	probably benign	0.06
R9695:Olfr1076	UTSW	2	86508756	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGTGCAATGATTTCCACTCAGAAC -3'
(R):5'- TGGCGACATACCAGTCATAAGAC -3'

Sequencing Primer
(F):5'- TCTGATGGAGAATCACAACCTC -3'
(R):5'- GAAAGACAATTGGACAGCAC -3'

Posted On

2016-12-15