Incidental Mutation 'R5783:Olfr1076'
ID447841
Institutional Source Beutler Lab
Gene Symbol Olfr1076
Ensembl Gene ENSMUSG00000060742
Gene Nameolfactory receptor 1076
SynonymsGA_x6K02T2Q125-47993761-47994702, MOR189-2
MMRRC Submission 043380-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5783 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86508461-86509402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86508638 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 60 (Y60H)
Ref Sequence ENSEMBL: ENSMUSP00000075612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076263]
Predicted Effect probably damaging
Transcript: ENSMUST00000076263
AA Change: Y60H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075612
Gene: ENSMUSG00000060742
AA Change: Y60H

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 4.6e-52 PFAM
Pfam:7tm_1 41 290 5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217442
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,518,787 Y48F probably damaging Het
4930402H24Rik A C 2: 130,739,083 F582L possibly damaging Het
AI481877 A T 4: 59,076,239 L568* probably null Het
Apob A G 12: 8,001,022 D1082G probably damaging Het
Cald1 G A 6: 34,753,533 A236T possibly damaging Het
Ccdc88b A C 19: 6,853,916 C553G probably benign Het
Cenpe A G 3: 135,261,580 D2161G probably benign Het
Cep78 G T 19: 15,956,359 N618K probably benign Het
Chka A G 19: 3,864,661 N118D probably damaging Het
Dennd5a A C 7: 109,894,636 I1263S probably damaging Het
Dnm3 T C 1: 162,355,471 T92A possibly damaging Het
Dpp9 T C 17: 56,211,655 K50E probably damaging Het
Fen1 G T 19: 10,200,830 Y83* probably null Het
Gm1110 A G 9: 26,882,336 I532T probably benign Het
Hist2h2be T C 3: 96,221,299 V45A possibly damaging Het
Impdh1 A T 6: 29,206,343 F140Y possibly damaging Het
Kcnc4 T C 3: 107,447,872 D420G possibly damaging Het
Kctd19 A G 8: 105,386,980 V664A probably benign Het
Krt80 C T 15: 101,359,479 probably null Het
Lars2 T G 9: 123,461,596 M876R probably benign Het
Lrrc9 A G 12: 72,456,053 E266G possibly damaging Het
Mesd T A 7: 83,895,675 V120E probably damaging Het
Mogs C T 6: 83,118,671 T823I probably damaging Het
Mrgprh C A 17: 12,877,446 T191N probably benign Het
Mtss1 C T 15: 58,943,524 S729N probably benign Het
Muc5b G T 7: 141,858,428 E1704* probably null Het
Olfr631 A T 7: 103,928,942 I40F probably damaging Het
Olfr695 C A 7: 106,873,334 V304F probably damaging Het
Osbpl8 T A 10: 111,267,783 L216* probably null Het
Pcdha5 T C 18: 36,962,481 V681A probably benign Het
Pgap3 A C 11: 98,390,464 V190G probably benign Het
Ppp2r5a A T 1: 191,354,640 Y373N probably damaging Het
Prkdc T C 16: 15,717,801 L1675P probably damaging Het
Rapgef2 T G 3: 79,087,993 I635L probably benign Het
Rusc1 T C 3: 89,088,145 D193G probably damaging Het
Ryr3 C T 2: 112,652,998 V4140I probably benign Het
Scamp5 A G 9: 57,446,070 probably null Het
Slc41a3 T C 6: 90,619,542 I31T probably benign Het
Smad9 T C 3: 54,794,442 V368A probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
St8sia1 T C 6: 142,963,614 N52S possibly damaging Het
Svop T G 5: 114,064,935 D72A possibly damaging Het
Sybu T C 15: 44,746,414 I153V probably damaging Het
Tmem266 G T 9: 55,397,803 S32I probably damaging Het
Trpm4 G T 7: 45,310,389 R694S probably benign Het
Uqcrfs1 A G 13: 30,545,204 L15P probably damaging Het
Vrtn T A 12: 84,650,477 L667Q probably benign Het
Zc3h14 T A 12: 98,757,175 S241R probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp617 C A 8: 71,932,464 H213N probably damaging Het
Zfp638 G A 6: 83,944,847 G652D possibly damaging Het
Zmiz2 T C 11: 6,405,081 L916P probably damaging Het
Other mutations in Olfr1076
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Olfr1076 APN 2 86509169 missense possibly damaging 0.91
IGL03157:Olfr1076 APN 2 86509023 missense possibly damaging 0.95
ANU05:Olfr1076 UTSW 2 86509169 missense possibly damaging 0.91
IGL02802:Olfr1076 UTSW 2 86508946 missense probably benign
R0325:Olfr1076 UTSW 2 86509205 missense probably benign 0.14
R0384:Olfr1076 UTSW 2 86509383 missense possibly damaging 0.80
R1164:Olfr1076 UTSW 2 86508684 missense probably damaging 1.00
R1618:Olfr1076 UTSW 2 86508849 missense probably damaging 1.00
R1915:Olfr1076 UTSW 2 86508999 missense probably damaging 1.00
R1999:Olfr1076 UTSW 2 86508745 nonsense probably null
R2093:Olfr1076 UTSW 2 86509243 missense probably damaging 0.99
R3824:Olfr1076 UTSW 2 86509023 missense possibly damaging 0.95
R4259:Olfr1076 UTSW 2 86508999 missense probably damaging 1.00
R4928:Olfr1076 UTSW 2 86509125 missense probably damaging 1.00
R4981:Olfr1076 UTSW 2 86508827 missense probably damaging 1.00
R4998:Olfr1076 UTSW 2 86509355 missense probably benign 0.00
R6384:Olfr1076 UTSW 2 86509037 missense probably benign
R6549:Olfr1076 UTSW 2 86509382 missense probably benign 0.00
R6893:Olfr1076 UTSW 2 86508792 missense probably damaging 1.00
R7145:Olfr1076 UTSW 2 86508528 missense probably damaging 1.00
R7157:Olfr1076 UTSW 2 86509025 missense probably damaging 0.99
R7555:Olfr1076 UTSW 2 86509347 missense probably damaging 0.99
R7611:Olfr1076 UTSW 2 86509053 missense possibly damaging 0.84
R7640:Olfr1076 UTSW 2 86508943 missense possibly damaging 0.90
R7724:Olfr1076 UTSW 2 86508605 missense probably damaging 1.00
R7965:Olfr1076 UTSW 2 86508471 missense probably benign
R8367:Olfr1076 UTSW 2 86508681 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGTGCAATGATTTCCACTCAGAAC -3'
(R):5'- TGGCGACATACCAGTCATAAGAC -3'

Sequencing Primer
(F):5'- TCTGATGGAGAATCACAACCTC -3'
(R):5'- GAAAGACAATTGGACAGCAC -3'
Posted On2016-12-15