Incidental Mutation 'R5783:Kctd19'
ID 447868
Institutional Source Beutler Lab
Gene Symbol Kctd19
Ensembl Gene ENSMUSG00000051648
Gene Name potassium channel tetramerisation domain containing 19
Synonyms 4922504H04Rik
MMRRC Submission 043380-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R5783 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 106109439-106140134 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106113612 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 664 (V664A)
Ref Sequence ENSEMBL: ENSMUSP00000130831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000063071] [ENSMUST00000159286] [ENSMUST00000160191] [ENSMUST00000167294] [ENSMUST00000168196] [ENSMUST00000214056]
AlphaFold Q562E2
Predicted Effect probably benign
Transcript: ENSMUST00000014927
SMART Domains Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
low complexity region 364 377 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
RhoGEF 729 900 3.15e-29 SMART
PH 914 1022 1.44e-5 SMART
low complexity region 1148 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063071
AA Change: V687A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648
AA Change: V687A

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000159286
SMART Domains Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
SCOP:d1aua_2 136 275 5e-9 SMART
Blast:SEC14 137 271 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160191
SMART Domains Protein: ENSMUSP00000125249
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
low complexity region 295 308 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 466 478 N/A INTRINSIC
low complexity region 490 508 N/A INTRINSIC
low complexity region 584 595 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
RhoGEF 660 831 3.15e-29 SMART
PH 845 953 1.44e-5 SMART
low complexity region 1079 1100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161672
Predicted Effect probably benign
Transcript: ENSMUST00000167294
AA Change: V664A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648
AA Change: V664A

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168196
Predicted Effect probably benign
Transcript: ENSMUST00000214056
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,468,787 (GRCm39) Y48F probably damaging Het
Apob A G 12: 8,051,022 (GRCm39) D1082G probably damaging Het
Cald1 G A 6: 34,730,468 (GRCm39) A236T possibly damaging Het
Ccdc88b A C 19: 6,831,284 (GRCm39) C553G probably benign Het
Cenpe A G 3: 134,967,341 (GRCm39) D2161G probably benign Het
Cep78 G T 19: 15,933,723 (GRCm39) N618K probably benign Het
Chka A G 19: 3,914,661 (GRCm39) N118D probably damaging Het
Dennd5a A C 7: 109,493,843 (GRCm39) I1263S probably damaging Het
Dnaaf9 A C 2: 130,581,003 (GRCm39) F582L possibly damaging Het
Dnm3 T C 1: 162,183,040 (GRCm39) T92A possibly damaging Het
Dpp9 T C 17: 56,518,655 (GRCm39) K50E probably damaging Het
Fen1 G T 19: 10,178,194 (GRCm39) Y83* probably null Het
Gm1110 A G 9: 26,793,632 (GRCm39) I532T probably benign Het
H2bc21 T C 3: 96,128,615 (GRCm39) V45A possibly damaging Het
Impdh1 A T 6: 29,206,342 (GRCm39) F140Y possibly damaging Het
Kcnc4 T C 3: 107,355,188 (GRCm39) D420G possibly damaging Het
Krt80 C T 15: 101,257,360 (GRCm39) probably null Het
Lars2 T G 9: 123,290,661 (GRCm39) M876R probably benign Het
Lrrc9 A G 12: 72,502,827 (GRCm39) E266G possibly damaging Het
Mesd T A 7: 83,544,883 (GRCm39) V120E probably damaging Het
Mogs C T 6: 83,095,652 (GRCm39) T823I probably damaging Het
Mrgprh C A 17: 13,096,333 (GRCm39) T191N probably benign Het
Mtss1 C T 15: 58,815,373 (GRCm39) S729N probably benign Het
Muc5b G T 7: 141,412,165 (GRCm39) E1704* probably null Het
Or2ag13 C A 7: 106,472,541 (GRCm39) V304F probably damaging Het
Or51m1 A T 7: 103,578,149 (GRCm39) I40F probably damaging Het
Or8k30 T C 2: 86,338,982 (GRCm39) Y60H probably damaging Het
Osbpl8 T A 10: 111,103,644 (GRCm39) L216* probably null Het
Pcdha5 T C 18: 37,095,534 (GRCm39) V681A probably benign Het
Pgap3 A C 11: 98,281,290 (GRCm39) V190G probably benign Het
Ppp2r5a A T 1: 191,086,837 (GRCm39) Y373N probably damaging Het
Prkdc T C 16: 15,535,665 (GRCm39) L1675P probably damaging Het
Rapgef2 T G 3: 78,995,300 (GRCm39) I635L probably benign Het
Rusc1 T C 3: 88,995,452 (GRCm39) D193G probably damaging Het
Ryr3 C T 2: 112,483,343 (GRCm39) V4140I probably benign Het
Scamp5 A G 9: 57,353,353 (GRCm39) probably null Het
Shoc1 A T 4: 59,076,239 (GRCm39) L568* probably null Het
Slc41a3 T C 6: 90,596,524 (GRCm39) I31T probably benign Het
Smad9 T C 3: 54,701,863 (GRCm39) V368A probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 (GRCm39) probably benign Het
St8sia1 T C 6: 142,909,340 (GRCm39) N52S possibly damaging Het
Svop T G 5: 114,202,996 (GRCm39) D72A possibly damaging Het
Sybu T C 15: 44,609,810 (GRCm39) I153V probably damaging Het
Tmem266 G T 9: 55,305,087 (GRCm39) S32I probably damaging Het
Trpm4 G T 7: 44,959,813 (GRCm39) R694S probably benign Het
Uqcrfs1 A G 13: 30,729,187 (GRCm39) L15P probably damaging Het
Vrtn T A 12: 84,697,251 (GRCm39) L667Q probably benign Het
Zc3h14 T A 12: 98,723,434 (GRCm39) S241R probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,723,440 (GRCm39) probably benign Het
Zfp617 C A 8: 72,686,308 (GRCm39) H213N probably damaging Het
Zfp638 G A 6: 83,921,829 (GRCm39) G652D possibly damaging Het
Zmiz2 T C 11: 6,355,081 (GRCm39) L916P probably damaging Het
Other mutations in Kctd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Kctd19 APN 8 106,115,095 (GRCm39) critical splice donor site probably null
IGL01546:Kctd19 APN 8 106,113,594 (GRCm39) missense probably benign
IGL01786:Kctd19 APN 8 106,116,936 (GRCm39) missense probably benign 0.03
IGL01964:Kctd19 APN 8 106,115,157 (GRCm39) missense probably damaging 0.99
IGL02275:Kctd19 APN 8 106,123,006 (GRCm39) missense probably damaging 0.99
IGL02479:Kctd19 APN 8 106,111,400 (GRCm39) missense probably damaging 1.00
IGL03124:Kctd19 APN 8 106,113,702 (GRCm39) missense possibly damaging 0.48
R0003:Kctd19 UTSW 8 106,121,993 (GRCm39) missense probably damaging 0.99
R1183:Kctd19 UTSW 8 106,109,598 (GRCm39) missense probably benign
R1388:Kctd19 UTSW 8 106,118,683 (GRCm39) missense probably null 0.93
R1491:Kctd19 UTSW 8 106,113,694 (GRCm39) missense possibly damaging 0.60
R1517:Kctd19 UTSW 8 106,122,008 (GRCm39) missense probably damaging 1.00
R1540:Kctd19 UTSW 8 106,114,511 (GRCm39) missense probably damaging 0.96
R1582:Kctd19 UTSW 8 106,122,092 (GRCm39) missense probably damaging 1.00
R1964:Kctd19 UTSW 8 106,115,102 (GRCm39) missense probably damaging 0.98
R1996:Kctd19 UTSW 8 106,121,932 (GRCm39) missense probably null 1.00
R2129:Kctd19 UTSW 8 106,111,804 (GRCm39) missense probably damaging 0.98
R2281:Kctd19 UTSW 8 106,113,898 (GRCm39) missense probably benign 0.00
R3767:Kctd19 UTSW 8 106,123,112 (GRCm39) missense probably benign 0.04
R3768:Kctd19 UTSW 8 106,123,112 (GRCm39) missense probably benign 0.04
R4285:Kctd19 UTSW 8 106,109,581 (GRCm39) unclassified probably benign
R4621:Kctd19 UTSW 8 106,123,103 (GRCm39) missense probably damaging 1.00
R4701:Kctd19 UTSW 8 106,117,061 (GRCm39) missense possibly damaging 0.76
R4969:Kctd19 UTSW 8 106,122,959 (GRCm39) splice site probably null
R5070:Kctd19 UTSW 8 106,118,631 (GRCm39) missense probably damaging 1.00
R5401:Kctd19 UTSW 8 106,109,617 (GRCm39) missense probably benign 0.00
R5582:Kctd19 UTSW 8 106,135,075 (GRCm39) missense probably damaging 1.00
R6056:Kctd19 UTSW 8 106,123,082 (GRCm39) missense probably damaging 0.99
R6057:Kctd19 UTSW 8 106,123,082 (GRCm39) missense probably damaging 0.99
R6269:Kctd19 UTSW 8 106,121,992 (GRCm39) missense possibly damaging 0.96
R6273:Kctd19 UTSW 8 106,112,117 (GRCm39) missense probably benign
R6631:Kctd19 UTSW 8 106,111,960 (GRCm39) critical splice donor site probably null
R7298:Kctd19 UTSW 8 106,109,616 (GRCm39) missense probably benign 0.01
R7474:Kctd19 UTSW 8 106,118,664 (GRCm39) missense probably benign 0.25
R7540:Kctd19 UTSW 8 106,113,567 (GRCm39) missense probably benign 0.00
R7923:Kctd19 UTSW 8 106,111,690 (GRCm39) missense probably damaging 1.00
R8059:Kctd19 UTSW 8 106,122,983 (GRCm39) missense probably benign 0.02
R8117:Kctd19 UTSW 8 106,122,069 (GRCm39) missense unknown
R8836:Kctd19 UTSW 8 106,112,028 (GRCm39) missense probably damaging 0.98
R9155:Kctd19 UTSW 8 106,120,571 (GRCm39) missense probably benign 0.01
R9429:Kctd19 UTSW 8 106,109,652 (GRCm39) missense probably damaging 0.98
R9481:Kctd19 UTSW 8 106,120,249 (GRCm39) missense probably benign 0.00
R9627:Kctd19 UTSW 8 106,113,997 (GRCm39) missense probably benign 0.01
Z1088:Kctd19 UTSW 8 106,111,967 (GRCm39) missense probably benign 0.02
Z1176:Kctd19 UTSW 8 106,111,768 (GRCm39) missense probably damaging 1.00
Z1177:Kctd19 UTSW 8 106,115,149 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCAGTCCTTTAGGGTAATAGC -3'
(R):5'- AGACATTGGGGAGGTCACTCTG -3'

Sequencing Primer
(F):5'- AATAGCTCTTTTTGTAGGGAAGTATG -3'
(R):5'- AGGTCACTCTGAGAGTCCC -3'
Posted On 2016-12-15