Incidental Mutation 'R5783:Tmem266'
ID447870
Institutional Source Beutler Lab
Gene Symbol Tmem266
Ensembl Gene ENSMUSG00000032313
Gene Nametransmembrane protein 266
SynonymsAI118078
MMRRC Submission 043380-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5783 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location55326913-55438345 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55397803 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 32 (S32I)
Ref Sequence ENSEMBL: ENSMUSP00000082906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034862] [ENSMUST00000085754]
Predicted Effect probably damaging
Transcript: ENSMUST00000034862
AA Change: S97I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034862
Gene: ENSMUSG00000032313
AA Change: S97I

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 172 191 N/A INTRINSIC
low complexity region 260 283 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
low complexity region 381 396 N/A INTRINSIC
low complexity region 423 439 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085754
AA Change: S32I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082906
Gene: ENSMUSG00000032313
AA Change: S32I

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 195 218 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130465
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,518,787 Y48F probably damaging Het
4930402H24Rik A C 2: 130,739,083 F582L possibly damaging Het
AI481877 A T 4: 59,076,239 L568* probably null Het
Apob A G 12: 8,001,022 D1082G probably damaging Het
Cald1 G A 6: 34,753,533 A236T possibly damaging Het
Ccdc88b A C 19: 6,853,916 C553G probably benign Het
Cenpe A G 3: 135,261,580 D2161G probably benign Het
Cep78 G T 19: 15,956,359 N618K probably benign Het
Chka A G 19: 3,864,661 N118D probably damaging Het
Dennd5a A C 7: 109,894,636 I1263S probably damaging Het
Dnm3 T C 1: 162,355,471 T92A possibly damaging Het
Dpp9 T C 17: 56,211,655 K50E probably damaging Het
Fen1 G T 19: 10,200,830 Y83* probably null Het
Gm1110 A G 9: 26,882,336 I532T probably benign Het
Hist2h2be T C 3: 96,221,299 V45A possibly damaging Het
Impdh1 A T 6: 29,206,343 F140Y possibly damaging Het
Kcnc4 T C 3: 107,447,872 D420G possibly damaging Het
Kctd19 A G 8: 105,386,980 V664A probably benign Het
Krt80 C T 15: 101,359,479 probably null Het
Lars2 T G 9: 123,461,596 M876R probably benign Het
Lrrc9 A G 12: 72,456,053 E266G possibly damaging Het
Mesd T A 7: 83,895,675 V120E probably damaging Het
Mogs C T 6: 83,118,671 T823I probably damaging Het
Mrgprh C A 17: 12,877,446 T191N probably benign Het
Mtss1 C T 15: 58,943,524 S729N probably benign Het
Muc5b G T 7: 141,858,428 E1704* probably null Het
Olfr1076 T C 2: 86,508,638 Y60H probably damaging Het
Olfr631 A T 7: 103,928,942 I40F probably damaging Het
Olfr695 C A 7: 106,873,334 V304F probably damaging Het
Osbpl8 T A 10: 111,267,783 L216* probably null Het
Pcdha5 T C 18: 36,962,481 V681A probably benign Het
Pgap3 A C 11: 98,390,464 V190G probably benign Het
Ppp2r5a A T 1: 191,354,640 Y373N probably damaging Het
Prkdc T C 16: 15,717,801 L1675P probably damaging Het
Rapgef2 T G 3: 79,087,993 I635L probably benign Het
Rusc1 T C 3: 89,088,145 D193G probably damaging Het
Ryr3 C T 2: 112,652,998 V4140I probably benign Het
Scamp5 A G 9: 57,446,070 probably null Het
Slc41a3 T C 6: 90,619,542 I31T probably benign Het
Smad9 T C 3: 54,794,442 V368A probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
St8sia1 T C 6: 142,963,614 N52S possibly damaging Het
Svop T G 5: 114,064,935 D72A possibly damaging Het
Sybu T C 15: 44,746,414 I153V probably damaging Het
Trpm4 G T 7: 45,310,389 R694S probably benign Het
Uqcrfs1 A G 13: 30,545,204 L15P probably damaging Het
Vrtn T A 12: 84,650,477 L667Q probably benign Het
Zc3h14 T A 12: 98,757,175 S241R probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp617 C A 8: 71,932,464 H213N probably damaging Het
Zfp638 G A 6: 83,944,847 G652D possibly damaging Het
Zmiz2 T C 11: 6,405,081 L916P probably damaging Het
Other mutations in Tmem266
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Tmem266 APN 9 55435202 missense probably benign 0.12
IGL03366:Tmem266 APN 9 55437233 missense probably benign 0.06
R0088:Tmem266 UTSW 9 55437329 missense probably damaging 1.00
R0418:Tmem266 UTSW 9 55437413 missense probably benign 0.06
R0497:Tmem266 UTSW 9 55380884 splice site probably null
R0763:Tmem266 UTSW 9 55414955 missense probably damaging 1.00
R1657:Tmem266 UTSW 9 55418008 missense probably damaging 1.00
R3617:Tmem266 UTSW 9 55400634 missense probably damaging 0.99
R4235:Tmem266 UTSW 9 55418107 missense probably damaging 0.99
R4767:Tmem266 UTSW 9 55380741 missense probably damaging 1.00
R5587:Tmem266 UTSW 9 55437566 missense probably damaging 1.00
R5732:Tmem266 UTSW 9 55380836 missense probably damaging 1.00
R6193:Tmem266 UTSW 9 55437209 missense probably benign 0.01
R6943:Tmem266 UTSW 9 55377567 start gained probably benign
R7459:Tmem266 UTSW 9 55396599 missense unknown
X0063:Tmem266 UTSW 9 55380749 missense probably benign 0.00
Z1177:Tmem266 UTSW 9 55397767 missense probably damaging 1.00
Z1177:Tmem266 UTSW 9 55437470 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AAGACTCGTCTCTCAGGAAGCC -3'
(R):5'- AATCTCAGTGCAGGTTGGGG -3'

Sequencing Primer
(F):5'- AAGCCCAGCCGCTGATGTAG -3'
(R):5'- ACTCACACTGGAGAAGCT -3'
Posted On2016-12-15