Mutagenetix > Incidental Mutation

Incidental Mutation 'R0545:Zc3h7a'

44788

Institutional Source

Beutler Lab

Gene Symbol

Zc3h7a

Ensembl Gene

ENSMUSG00000037965

Gene Name

zinc finger CCCH type containing 7 A

Synonyms

Zc3h7, A430104C18Rik

MMRRC Submission

038737-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.144) question?

Stock #

R0545 (G1)

Quality Score

209

Status

Validated

Chromosome

Chromosomal Location

11136592-11176393 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 11152333 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037633] [ENSMUST00000128083] [ENSMUST00000130355] [ENSMUST00000138185] [ENSMUST00000140755]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000037633

SMART Domains

Protein: ENSMUSP00000041308
Gene: ENSMUSG00000037965

Domain	Start	End	E-Value	Type
PDB:2DBA\|A	26	157	9e-7	PDB
Blast:TPR	43	76	1e-7	BLAST
SCOP:d1ihga1	46	169	1e-11	SMART
Blast:TPR	124	156	9e-9	BLAST
low complexity region	308	319	N/A	INTRINSIC
low complexity region	380	398	N/A	INTRINSIC
ZnF_C2H2	443	467	1.83e2	SMART
ZnF_C3H1	630	654	1.57e1	SMART
ZnF_C3H1	770	795	8.81e0	SMART
ZnF_C2H2	856	880	1.62e0	SMART
ZnF_C3H1	902	926	1.76e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128083

SMART Domains

Protein: ENSMUSP00000114246
Gene: ENSMUSG00000037965

Domain	Start	End	E-Value	Type
Pfam:TPR_11	41	120	2.7e-8	PFAM
Blast:TPR	124	156	4e-9	BLAST
low complexity region	308	319	N/A	INTRINSIC
low complexity region	380	398	N/A	INTRINSIC
Blast:ZnF_C2H2	443	467	2e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000130355

SMART Domains

Protein: ENSMUSP00000120931
Gene: ENSMUSG00000037965

Domain	Start	End	E-Value	Type
Pfam:TPR_11	41	120	4.4e-9	PFAM
Blast:TPR	124	156	2e-9	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000138185

SMART Domains

Protein: ENSMUSP00000119480
Gene: ENSMUSG00000037965

Domain	Start	End	E-Value	Type
Pfam:TPR_11	41	120	3.9e-8	PFAM
Blast:TPR	124	156	6e-9	BLAST
low complexity region	308	319	N/A	INTRINSIC
low complexity region	380	398	N/A	INTRINSIC
Blast:ZnF_C2H2	443	467	4e-10	BLAST
Blast:ZnF_C3H1	628	654	5e-10	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139391

Predicted Effect

probably benign
Transcript: ENSMUST00000140755

SMART Domains

Protein: ENSMUSP00000120720
Gene: ENSMUSG00000037965

Domain	Start	End	E-Value	Type
Pfam:TPR_11	41	120	1e-7	PFAM
Blast:TPR	124	156	5e-9	BLAST
low complexity region	308	319	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140775

Predicted Effect

probably benign
Transcript: ENSMUST00000140898

SMART Domains

Protein: ENSMUSP00000118771
Gene: ENSMUSG00000037965

Domain	Start	End	E-Value	Type
Blast:ZnF_C3H1	45	71	3e-10	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142844

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143926

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145457

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155340

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155343

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.9%
20x: 94.0%

Validation Efficiency

99% (66/67)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	C	T	2: 19,542,376	R76H	probably damaging	Het
4932438A13Rik	G	A	3: 36,987,690		probably benign	Het
Adnp2	T	C	18: 80,129,401	I598V	probably benign	Het
Ago3	T	C	4: 126,417,232	N63D	probably damaging	Het
Alkbh7	C	T	17: 56,999,012	R138*	probably null	Het
Atp6ap1l	T	C	13: 90,883,663	H300R	probably benign	Het
BC051076	C	T	5: 87,963,490		noncoding transcript	Het
Bpifb9a	T	A	2: 154,261,950	C104*	probably null	Het
Cacna2d2	T	C	9: 107,525,223	L826P	probably damaging	Het
Car5b	G	A	X: 163,979,301	R282C	probably damaging	Het
Ccdc88c	T	C	12: 100,947,188	D526G	probably damaging	Het
Cdh23	T	A	10: 60,331,291	T1861S	probably benign	Het
Ces2f	A	C	8: 104,950,036	M121L	possibly damaging	Het
Cfap58	G	A	19: 47,941,097		probably benign	Het
Chpf2	T	C	5: 24,590,324	S282P	possibly damaging	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Cma2	A	T	14: 55,973,113	M86L	probably benign	Het
Cog6	A	T	3: 52,996,075	M134K	probably damaging	Het
Col1a1	A	G	11: 94,951,594	D1446G	unknown	Het
Cpne8	T	A	15: 90,497,075	D512V	probably damaging	Het
Ctnna2	T	A	6: 77,605,182	N352I	probably damaging	Het
Cyp2c69	A	C	19: 39,886,661	L16R	probably damaging	Het
Dysf	T	C	6: 84,099,461	S603P	probably damaging	Het
Epha5	A	G	5: 84,067,358		probably null	Het
Ercc3	T	C	18: 32,245,902	S270P	probably damaging	Het
F10	T	A	8: 13,048,249	C151S	probably damaging	Het
Gpr180	T	G	14: 118,160,046	H317Q	possibly damaging	Het
Gstp2	T	C	19: 4,041,633	E32G	possibly damaging	Het
Ikzf5	T	C	7: 131,392,500	T133A	possibly damaging	Het
Itch	G	T	2: 155,182,298	G274*	probably null	Het
Jarid2	T	A	13: 44,902,831	N365K	probably benign	Het
Lama3	T	A	18: 12,561,701	S1295T	possibly damaging	Het
Lipc	A	G	9: 70,812,705	L255P	probably damaging	Het
Lrrc38	A	G	4: 143,350,758	D197G	probably benign	Het
Mfap2	A	G	4: 141,014,185		probably benign	Het
Mfhas1	A	G	8: 35,589,048	K226E	probably damaging	Het
Morc1	A	G	16: 48,565,657	R548G	probably benign	Het
Mrgprb5	T	C	7: 48,168,885	N34S	probably benign	Het
Mroh4	T	C	15: 74,625,427	T182A	probably benign	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Myo5a	T	C	9: 75,167,037	F743L	possibly damaging	Het
Notch4	A	C	17: 34,583,433	D1276A	probably damaging	Het
Olfr139	A	G	11: 74,045,047	C76R	possibly damaging	Het
Olfr215	T	A	6: 116,582,656	I97L	probably benign	Het
Olfr394	A	T	11: 73,888,017	Y118*	probably null	Het
Olfr799	T	A	10: 129,647,349	C74S	probably damaging	Het
Plin4	T	A	17: 56,106,567	T353S	probably damaging	Het
Ppp1r9a	A	G	6: 5,115,357	T827A	probably benign	Het
Prlr	C	T	15: 10,317,566	T40I	probably damaging	Het
Psme3	T	C	11: 101,319,904		probably benign	Het
Pygb	A	T	2: 150,815,706	D363V	probably benign	Het
Rsph6a	C	T	7: 19,054,946	Q68*	probably null	Het
Serpini2	A	G	3: 75,258,138	V178A	probably benign	Het
Sh2d2a	T	C	3: 87,851,888		probably benign	Het
Skint7	A	C	4: 111,980,198	M58L	probably benign	Het
Slco3a1	G	T	7: 74,320,553	Y435*	probably null	Het
Stk17b	T	C	1: 53,762,583		probably benign	Het
Tinag	T	A	9: 77,031,710	H162L	possibly damaging	Het
Ttc21a	T	A	9: 119,958,799	L811Q	probably damaging	Het
Ttc41	A	T	10: 86,759,097	M912L	probably benign	Het
Vmn2r98	G	T	17: 19,053,613	V41F	probably benign	Het
Washc5	C	T	15: 59,342,093	C838Y	possibly damaging	Het
Wrnip1	A	G	13: 32,806,813	T352A	probably damaging	Het
Zan	A	C	5: 137,396,177	C4467G	unknown	Het
Zfp729a	C	A	13: 67,620,226	C628F	probably benign	Het

Other mutations in Zc3h7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Zc3h7a	APN	16	11137338	missense	probably damaging	0.98
IGL00908:Zc3h7a	APN	16	11145242	missense	probably damaging	0.99
IGL01087:Zc3h7a	APN	16	11153182	missense	probably benign	0.28
IGL01285:Zc3h7a	APN	16	11139115	missense	probably damaging	1.00
IGL01453:Zc3h7a	APN	16	11149378	missense	probably benign	0.00
IGL01639:Zc3h7a	APN	16	11141708	missense	possibly damaging	0.75
IGL01716:Zc3h7a	APN	16	11145716	missense	probably damaging	1.00
IGL02059:Zc3h7a	APN	16	11160998	unclassified	probably benign
IGL02170:Zc3h7a	APN	16	11146395	missense	probably benign
IGL02256:Zc3h7a	APN	16	11147276	missense	probably benign	0.04
IGL02904:Zc3h7a	APN	16	11150666	missense	probably damaging	1.00
IGL02941:Zc3h7a	APN	16	11158594	critical splice acceptor site	probably null
IGL03198:Zc3h7a	APN	16	11162664	nonsense	probably null
IGL03201:Zc3h7a	APN	16	11156302	critical splice acceptor site	probably null
IGL03302:Zc3h7a	APN	16	11141710	missense	probably damaging	1.00
agreement	UTSW	16	11153161	missense	probably benign	0.02
Clement	UTSW	16	11164602	nonsense	probably null
consensus	UTSW	16	11161026	missense	probably damaging	1.00
R0062:Zc3h7a	UTSW	16	11139147	missense	probably damaging	1.00
R0255:Zc3h7a	UTSW	16	11140737	missense	probably damaging	1.00
R0376:Zc3h7a	UTSW	16	11156202	missense	probably benign	0.00
R0666:Zc3h7a	UTSW	16	11156303	unclassified	probably benign
R0831:Zc3h7a	UTSW	16	11151880	missense	probably damaging	0.99
R1127:Zc3h7a	UTSW	16	11139075	missense	probably damaging	1.00
R1296:Zc3h7a	UTSW	16	11161026	missense	probably damaging	1.00
R1472:Zc3h7a	UTSW	16	11161026	missense	probably damaging	1.00
R1499:Zc3h7a	UTSW	16	11162656	missense	probably damaging	1.00
R1747:Zc3h7a	UTSW	16	11145253	missense	possibly damaging	0.67
R1786:Zc3h7a	UTSW	16	11150605	nonsense	probably null
R1840:Zc3h7a	UTSW	16	11161026	missense	probably damaging	1.00
R1866:Zc3h7a	UTSW	16	11147304	missense	possibly damaging	0.81
R2055:Zc3h7a	UTSW	16	11137476	missense	probably benign	0.00
R2131:Zc3h7a	UTSW	16	11150605	nonsense	probably null
R2281:Zc3h7a	UTSW	16	11158594	unclassified	probably benign
R2399:Zc3h7a	UTSW	16	11147401	missense	probably damaging	1.00
R2979:Zc3h7a	UTSW	16	11158973	missense	probably damaging	1.00
R3915:Zc3h7a	UTSW	16	11156210	missense	possibly damaging	0.92
R4078:Zc3h7a	UTSW	16	11151147	missense	probably benign	0.05
R4095:Zc3h7a	UTSW	16	11145235	missense	probably damaging	1.00
R4208:Zc3h7a	UTSW	16	11164644	missense	possibly damaging	0.60
R4444:Zc3h7a	UTSW	16	11150593	critical splice donor site	probably null
R4739:Zc3h7a	UTSW	16	11141709	missense	probably damaging	1.00
R5059:Zc3h7a	UTSW	16	11161121	frame shift	probably null
R5545:Zc3h7a	UTSW	16	11148451	missense	possibly damaging	0.89
R5815:Zc3h7a	UTSW	16	11156186	missense	probably damaging	0.98
R5915:Zc3h7a	UTSW	16	11164602	nonsense	probably null
R5993:Zc3h7a	UTSW	16	11150662	missense	probably damaging	1.00
R6183:Zc3h7a	UTSW	16	11147370	missense	possibly damaging	0.81
R6459:Zc3h7a	UTSW	16	11153161	missense	probably damaging	1.00
R6513:Zc3h7a	UTSW	16	11158765	critical splice acceptor site	probably null
R6700:Zc3h7a	UTSW	16	11158967	missense	possibly damaging	0.59
R6904:Zc3h7a	UTSW	16	11145671	missense	probably damaging	1.00
R6964:Zc3h7a	UTSW	16	11149224	missense	probably benign	0.00
R7354:Zc3h7a	UTSW	16	11148514	missense	probably damaging	1.00
R7667:Zc3h7a	UTSW	16	11139026	nonsense	probably null
R7742:Zc3h7a	UTSW	16	11153161	missense	probably benign	0.02
R7780:Zc3h7a	UTSW	16	11149251	missense	probably benign	0.26
R8228:Zc3h7a	UTSW	16	11139090	missense	probably damaging	1.00
R8302:Zc3h7a	UTSW	16	11137385	missense	probably damaging	1.00
R8309:Zc3h7a	UTSW	16	11146553	intron	probably benign
R8795:Zc3h7a	UTSW	16	11147283	missense	possibly damaging	0.65
R9060:Zc3h7a	UTSW	16	11151183	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTACAGCAGGGTCTACTGAACAGG -3'
(R):5'- TGCGTAGGCATGGGAATGTCAC -3'

Sequencing Primer
(F):5'- CAGGGTCTACTGAACAGGACTAAG -3'
(R):5'- ttaataactTTTAGACTTGGTTGGGC -3'

Posted On

2013-06-11