Incidental Mutation 'R5783:Cep78'
ID447893
Institutional Source Beutler Lab
Gene Symbol Cep78
Ensembl Gene ENSMUSG00000041491
Gene Namecentrosomal protein 78
Synonyms5730599I05Rik
MMRRC Submission 043380-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R5783 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location15955774-15984989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 15956359 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 618 (N618K)
Ref Sequence ENSEMBL: ENSMUSP00000037596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047704]
Predicted Effect probably benign
Transcript: ENSMUST00000047704
AA Change: N618K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000037596
Gene: ENSMUSG00000041491
AA Change: N618K

DomainStartEndE-ValueType
LRR 152 179 2.95e-3 SMART
Blast:LRR 180 207 1e-10 BLAST
LRR 231 259 6.28e-1 SMART
LRR 260 287 8.81e-2 SMART
LRR 288 313 1.96e2 SMART
low complexity region 427 450 N/A INTRINSIC
coiled coil region 462 511 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,518,787 Y48F probably damaging Het
4930402H24Rik A C 2: 130,739,083 F582L possibly damaging Het
AI481877 A T 4: 59,076,239 L568* probably null Het
Apob A G 12: 8,001,022 D1082G probably damaging Het
Cald1 G A 6: 34,753,533 A236T possibly damaging Het
Ccdc88b A C 19: 6,853,916 C553G probably benign Het
Cenpe A G 3: 135,261,580 D2161G probably benign Het
Chka A G 19: 3,864,661 N118D probably damaging Het
Dennd5a A C 7: 109,894,636 I1263S probably damaging Het
Dnm3 T C 1: 162,355,471 T92A possibly damaging Het
Dpp9 T C 17: 56,211,655 K50E probably damaging Het
Fen1 G T 19: 10,200,830 Y83* probably null Het
Gm1110 A G 9: 26,882,336 I532T probably benign Het
Hist2h2be T C 3: 96,221,299 V45A possibly damaging Het
Impdh1 A T 6: 29,206,343 F140Y possibly damaging Het
Kcnc4 T C 3: 107,447,872 D420G possibly damaging Het
Kctd19 A G 8: 105,386,980 V664A probably benign Het
Krt80 C T 15: 101,359,479 probably null Het
Lars2 T G 9: 123,461,596 M876R probably benign Het
Lrrc9 A G 12: 72,456,053 E266G possibly damaging Het
Mesd T A 7: 83,895,675 V120E probably damaging Het
Mogs C T 6: 83,118,671 T823I probably damaging Het
Mrgprh C A 17: 12,877,446 T191N probably benign Het
Mtss1 C T 15: 58,943,524 S729N probably benign Het
Muc5b G T 7: 141,858,428 E1704* probably null Het
Olfr1076 T C 2: 86,508,638 Y60H probably damaging Het
Olfr631 A T 7: 103,928,942 I40F probably damaging Het
Olfr695 C A 7: 106,873,334 V304F probably damaging Het
Osbpl8 T A 10: 111,267,783 L216* probably null Het
Pcdha5 T C 18: 36,962,481 V681A probably benign Het
Pgap3 A C 11: 98,390,464 V190G probably benign Het
Ppp2r5a A T 1: 191,354,640 Y373N probably damaging Het
Prkdc T C 16: 15,717,801 L1675P probably damaging Het
Rapgef2 T G 3: 79,087,993 I635L probably benign Het
Rusc1 T C 3: 89,088,145 D193G probably damaging Het
Ryr3 C T 2: 112,652,998 V4140I probably benign Het
Scamp5 A G 9: 57,446,070 probably null Het
Slc41a3 T C 6: 90,619,542 I31T probably benign Het
Smad9 T C 3: 54,794,442 V368A probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
St8sia1 T C 6: 142,963,614 N52S possibly damaging Het
Svop T G 5: 114,064,935 D72A possibly damaging Het
Sybu T C 15: 44,746,414 I153V probably damaging Het
Tmem266 G T 9: 55,397,803 S32I probably damaging Het
Trpm4 G T 7: 45,310,389 R694S probably benign Het
Uqcrfs1 A G 13: 30,545,204 L15P probably damaging Het
Vrtn T A 12: 84,650,477 L667Q probably benign Het
Zc3h14 T A 12: 98,757,175 S241R probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp617 C A 8: 71,932,464 H213N probably damaging Het
Zfp638 G A 6: 83,944,847 G652D possibly damaging Het
Zmiz2 T C 11: 6,405,081 L916P probably damaging Het
Other mutations in Cep78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Cep78 APN 19 15969140 missense probably benign
IGL00920:Cep78 APN 19 15981486 missense probably benign 0.03
IGL01548:Cep78 APN 19 15981200 splice site probably benign
IGL01662:Cep78 APN 19 15960995 missense probably damaging 1.00
IGL01933:Cep78 APN 19 15955940 missense probably benign
IGL02014:Cep78 APN 19 15984738 missense probably damaging 1.00
IGL02198:Cep78 APN 19 15956369 missense probably damaging 1.00
IGL02331:Cep78 APN 19 15974415 missense probably benign 0.16
IGL02431:Cep78 APN 19 15959579 missense probably benign
IGL02731:Cep78 APN 19 15956306 missense probably benign 0.02
IGL03268:Cep78 APN 19 15974442 nonsense probably null
IGL03338:Cep78 APN 19 15959623 missense probably damaging 0.97
himalayas UTSW 19 15969128 missense possibly damaging 0.66
R0426:Cep78 UTSW 19 15970970 nonsense probably null
R0619:Cep78 UTSW 19 15978862 missense probably damaging 0.99
R0659:Cep78 UTSW 19 15956190 missense probably damaging 0.97
R1517:Cep78 UTSW 19 15959663 missense probably damaging 1.00
R1758:Cep78 UTSW 19 15959536 missense probably damaging 1.00
R1836:Cep78 UTSW 19 15969169 missense probably damaging 1.00
R1865:Cep78 UTSW 19 15956004 missense probably damaging 1.00
R1920:Cep78 UTSW 19 15974351 splice site probably benign
R2483:Cep78 UTSW 19 15960980 missense probably damaging 1.00
R2958:Cep78 UTSW 19 15978909 missense probably damaging 1.00
R3814:Cep78 UTSW 19 15981802 critical splice acceptor site probably null
R4133:Cep78 UTSW 19 15969155 missense probably damaging 1.00
R4214:Cep78 UTSW 19 15959579 missense probably benign
R5791:Cep78 UTSW 19 15961072 missense probably benign 0.19
R5910:Cep78 UTSW 19 15969128 missense possibly damaging 0.66
R5924:Cep78 UTSW 19 15961066 missense probably damaging 1.00
R6148:Cep78 UTSW 19 15981786 nonsense probably null
R6162:Cep78 UTSW 19 15974940 missense probably benign 0.28
R6235:Cep78 UTSW 19 15976486 intron probably null
R6968:Cep78 UTSW 19 15981738 missense probably benign 0.38
R7228:Cep78 UTSW 19 15969197 missense probably benign 0.01
R7913:Cep78 UTSW 19 15970577 missense probably benign
R7994:Cep78 UTSW 19 15970577 missense probably benign
R8059:Cep78 UTSW 19 15981512 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGAAGAAGACCTGCTGTGTTTAG -3'
(R):5'- TGATGTTTGTGCAGGAATAGAAACC -3'

Sequencing Primer
(F):5'- GACCTGCTGTGTTTAGACAAC -3'
(R):5'- TTTCACCTCTGTAGTGGC -3'
Posted On2016-12-15