Incidental Mutation 'R5784:Aox3'
ID447895
Institutional Source Beutler Lab
Gene Symbol Aox3
Ensembl Gene ENSMUSG00000064294
Gene Namealdehyde oxidase 3
SynonymsAOH1, 1200011D03Rik
MMRRC Submission 043381-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5784 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58113130-58200698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58153499 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 544 (D544G)
Ref Sequence ENSEMBL: ENSMUSP00000049391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040999]
PDB Structure
Crystal structure of the mouse liver Aldehyde Oxidase 3 (mAOX3) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000040999
AA Change: D544G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: D544G

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.4e-9 PFAM
Pfam:Fer2_2 91 165 1e-29 PFAM
Pfam:FAD_binding_5 239 419 1e-44 PFAM
CO_deh_flav_C 426 530 9.26e-24 SMART
Ald_Xan_dh_C 594 697 2.27e-41 SMART
Pfam:Ald_Xan_dh_C2 708 1241 8.7e-183 PFAM
low complexity region 1275 1286 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158650
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,607 R292G possibly damaging Het
4932416K20Rik T A 8: 104,797,629 noncoding transcript Het
Atg2a C A 19: 6,261,505 A1830D probably damaging Het
Casp1 T C 9: 5,299,337 I22T probably damaging Het
Ccdc141 A C 2: 77,029,327 L990W probably damaging Het
Cnbd2 A G 2: 156,338,657 T125A probably damaging Het
Cnep1r1 T A 8: 88,130,726 probably benign Het
Dhx38 G T 8: 109,559,613 Y348* probably null Het
Dnah7c A T 1: 46,524,068 I593L possibly damaging Het
Dpep3 T C 8: 105,978,743 D125G probably benign Het
Epb41l4b A C 4: 57,086,003 S191A probably damaging Het
Etl4 A G 2: 20,806,205 Y1033C possibly damaging Het
Fam193a T C 5: 34,466,223 L32P probably damaging Het
Gm8332 T A 12: 88,249,755 N116Y probably damaging Het
Grin2c T C 11: 115,258,295 E159G possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdhd2 A T 18: 76,967,145 D205V probably damaging Het
Helz T A 11: 107,670,481 N774K unknown Het
Idh3b A G 2: 130,279,671 V71A probably damaging Het
Lars T C 18: 42,219,899 M818V probably benign Het
Ltbp2 A G 12: 84,868,739 V162A probably damaging Het
Ltk G A 2: 119,754,359 Q136* probably null Het
Mafb A T 2: 160,366,541 C46S probably damaging Het
Map1s T C 8: 70,914,358 S636P probably damaging Het
Map3k13 A G 16: 21,898,641 K209E possibly damaging Het
Mppe1 T C 18: 67,228,027 N220D probably benign Het
Mydgf T C 17: 56,178,254 probably benign Het
Myh6 T C 14: 54,953,064 K999E possibly damaging Het
Nemp1 T A 10: 127,677,198 V34D possibly damaging Het
Npr2 A G 4: 43,632,801 E206G probably benign Het
Olfr1497 A T 19: 13,795,346 H88Q probably benign Het
Olfr248 G A 1: 174,391,399 C110Y probably damaging Het
Olfr309 T C 7: 86,306,535 N193D probably damaging Het
Papln A G 12: 83,781,980 N820S probably benign Het
Pcdh10 T G 3: 45,380,640 F463C probably damaging Het
Pde7a A G 3: 19,264,845 V12A probably benign Het
Radil G T 5: 142,487,513 H804Q possibly damaging Het
Rbfox1 A T 16: 7,224,339 D39V probably damaging Het
Rims2 T G 15: 39,535,987 probably null Het
Rnf121 A G 7: 102,035,376 F110S probably benign Het
Saxo2 C T 7: 82,634,874 V259I probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc2a3 A T 6: 122,735,417 probably null Het
Traf2 A T 2: 25,539,037 V6E probably benign Het
Trim43c A T 9: 88,847,643 N379I probably benign Het
Ubr4 C G 4: 139,425,218 C1973W probably damaging Het
Unc13a G T 8: 71,655,666 D514E possibly damaging Het
Wdr27 T A 17: 14,926,233 T167S probably damaging Het
Zfp174 A T 16: 3,854,574 E329V probably benign Het
Zfp422 A T 6: 116,626,810 I76N probably damaging Het
Other mutations in Aox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Aox3 APN 1 58169794 missense probably damaging 1.00
IGL01747:Aox3 APN 1 58159658 missense probably damaging 0.97
IGL01883:Aox3 APN 1 58138283 missense probably damaging 1.00
IGL01911:Aox3 APN 1 58152560 missense probably benign 0.04
IGL02017:Aox3 APN 1 58120992 missense probably damaging 1.00
IGL02120:Aox3 APN 1 58127650 missense probably benign 0.00
IGL02466:Aox3 APN 1 58158272 missense probably benign 0.28
IGL02545:Aox3 APN 1 58183486 missense probably damaging 1.00
IGL02572:Aox3 APN 1 58158367 missense probably damaging 1.00
IGL02746:Aox3 APN 1 58183542 missense possibly damaging 0.83
IGL02808:Aox3 APN 1 58142700 missense probably damaging 0.99
IGL02812:Aox3 APN 1 58165896 missense probably benign 0.00
IGL02982:Aox3 APN 1 58127687 missense probably benign 0.00
IGL03056:Aox3 APN 1 58159021 critical splice donor site probably null
IGL03182:Aox3 APN 1 58165887 missense probably benign 0.02
IGL03234:Aox3 APN 1 58152686 missense probably benign
IGL03374:Aox3 APN 1 58171848 missense probably damaging 1.00
amber UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0135:Aox3 UTSW 1 58125088 splice site probably benign
R0332:Aox3 UTSW 1 58142751 missense probably benign 0.00
R0626:Aox3 UTSW 1 58172299 missense possibly damaging 0.94
R1325:Aox3 UTSW 1 58176567 nonsense probably null
R1435:Aox3 UTSW 1 58163446 critical splice donor site probably null
R1438:Aox3 UTSW 1 58153178 missense probably benign
R1567:Aox3 UTSW 1 58194693 missense probably damaging 0.96
R1575:Aox3 UTSW 1 58152554 missense probably benign 0.04
R1759:Aox3 UTSW 1 58170646 splice site probably null
R1785:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1786:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1921:Aox3 UTSW 1 58180651 missense probably damaging 1.00
R1984:Aox3 UTSW 1 58153061 missense possibly damaging 0.88
R2012:Aox3 UTSW 1 58138232 missense probably benign 0.02
R2080:Aox3 UTSW 1 58186280 missense probably benign 0.06
R2121:Aox3 UTSW 1 58152549 splice site probably benign
R2126:Aox3 UTSW 1 58158216 missense probably benign 0.25
R2130:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2131:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2132:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2133:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2385:Aox3 UTSW 1 58138289 missense probably damaging 1.00
R2495:Aox3 UTSW 1 58188408 missense probably damaging 0.99
R4200:Aox3 UTSW 1 58188378 missense probably damaging 1.00
R4231:Aox3 UTSW 1 58114885 missense probably benign 0.12
R4591:Aox3 UTSW 1 58152656 missense probably damaging 0.99
R4627:Aox3 UTSW 1 58125035 missense probably damaging 0.98
R4831:Aox3 UTSW 1 58152566 missense probably damaging 0.97
R4864:Aox3 UTSW 1 58176487 missense probably damaging 1.00
R4976:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5007:Aox3 UTSW 1 58163424 missense probably benign
R5119:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5175:Aox3 UTSW 1 58172328 missense probably benign 0.01
R5360:Aox3 UTSW 1 58146508 missense probably damaging 1.00
R6050:Aox3 UTSW 1 58180655 missense possibly damaging 0.93
R6056:Aox3 UTSW 1 58169859 missense probably damaging 1.00
R6162:Aox3 UTSW 1 58159731 missense possibly damaging 0.75
R6181:Aox3 UTSW 1 58158946 missense probably benign 0.03
R6374:Aox3 UTSW 1 58172161 missense probably benign 0.11
R6662:Aox3 UTSW 1 58118615 missense probably damaging 1.00
R6809:Aox3 UTSW 1 58118681 missense probably damaging 0.99
R6810:Aox3 UTSW 1 58141431 missense probably benign 0.00
R6821:Aox3 UTSW 1 58150388 missense probably benign 0.04
R7039:Aox3 UTSW 1 58176555 missense probably damaging 1.00
R7116:Aox3 UTSW 1 58153530 missense probably benign 0.01
R7146:Aox3 UTSW 1 58158529 intron probably null
R7163:Aox3 UTSW 1 58119512 missense probably damaging 0.99
R7243:Aox3 UTSW 1 58138307 missense unknown
R7319:Aox3 UTSW 1 58152602 missense probably benign 0.04
R7423:Aox3 UTSW 1 58121069 missense possibly damaging 0.80
R7664:Aox3 UTSW 1 58119539 missense probably damaging 1.00
R7709:Aox3 UTSW 1 58180651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGTGCTGACGTCACC -3'
(R):5'- CACAGTAGCAACTTGAAATTCAAAG -3'

Sequencing Primer
(F):5'- TGCAGGCTACATTTCCGAG -3'
(R):5'- CTTGAAATTCAAAGTAAAACCAGGTC -3'
Posted On2016-12-15