Incidental Mutation 'R0545:Vmn2r98'
ID 44791
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission 038737-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R0545 (G1)
Quality Score 203
Status Validated
Chromosome 17
Chromosomal Location 19273755-19301573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 19273875 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 41 (V41F)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: V41F

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: V41F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,547,187 (GRCm39) R76H probably damaging Het
Adnp2 T C 18: 80,172,616 (GRCm39) I598V probably benign Het
Ago3 T C 4: 126,311,025 (GRCm39) N63D probably damaging Het
Alkbh7 C T 17: 57,306,012 (GRCm39) R138* probably null Het
Atp6ap1l T C 13: 91,031,782 (GRCm39) H300R probably benign Het
BC051076 C T 5: 88,111,349 (GRCm39) noncoding transcript Het
Bltp1 G A 3: 37,041,839 (GRCm39) probably benign Het
Bpifb9a T A 2: 154,103,870 (GRCm39) C104* probably null Het
Cacna2d2 T C 9: 107,402,422 (GRCm39) L826P probably damaging Het
Car5b G A X: 162,762,297 (GRCm39) R282C probably damaging Het
Ccdc88c T C 12: 100,913,447 (GRCm39) D526G probably damaging Het
Cdh23 T A 10: 60,167,070 (GRCm39) T1861S probably benign Het
Ces2f A C 8: 105,676,668 (GRCm39) M121L possibly damaging Het
Cfap58 G A 19: 47,929,536 (GRCm39) probably benign Het
Chpf2 T C 5: 24,795,322 (GRCm39) S282P possibly damaging Het
Cluap1 C T 16: 3,751,636 (GRCm39) R332W probably damaging Het
Cma2 A T 14: 56,210,570 (GRCm39) M86L probably benign Het
Cog6 A T 3: 52,903,496 (GRCm39) M134K probably damaging Het
Col1a1 A G 11: 94,842,420 (GRCm39) D1446G unknown Het
Cpne8 T A 15: 90,381,278 (GRCm39) D512V probably damaging Het
Ctnna2 T A 6: 77,582,165 (GRCm39) N352I probably damaging Het
Cyp2c69 A C 19: 39,875,105 (GRCm39) L16R probably damaging Het
Dysf T C 6: 84,076,443 (GRCm39) S603P probably damaging Het
Epha5 A G 5: 84,215,217 (GRCm39) probably null Het
Ercc3 T C 18: 32,378,955 (GRCm39) S270P probably damaging Het
F10 T A 8: 13,098,249 (GRCm39) C151S probably damaging Het
Gpr180 T G 14: 118,397,458 (GRCm39) H317Q possibly damaging Het
Gstp2 T C 19: 4,091,633 (GRCm39) E32G possibly damaging Het
Ikzf5 T C 7: 130,994,229 (GRCm39) T133A possibly damaging Het
Itch G T 2: 155,024,218 (GRCm39) G274* probably null Het
Jarid2 T A 13: 45,056,307 (GRCm39) N365K probably benign Het
Lama3 T A 18: 12,694,758 (GRCm39) S1295T possibly damaging Het
Lipc A G 9: 70,719,987 (GRCm39) L255P probably damaging Het
Lrrc38 A G 4: 143,077,328 (GRCm39) D197G probably benign Het
Mfap2 A G 4: 140,741,496 (GRCm39) probably benign Het
Mfhas1 A G 8: 36,056,202 (GRCm39) K226E probably damaging Het
Morc1 A G 16: 48,386,020 (GRCm39) R548G probably benign Het
Mrgprb5 T C 7: 47,818,633 (GRCm39) N34S probably benign Het
Mroh4 T C 15: 74,497,276 (GRCm39) T182A probably benign Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Myo5a T C 9: 75,074,319 (GRCm39) F743L possibly damaging Het
Notch4 A C 17: 34,802,407 (GRCm39) D1276A probably damaging Het
Or1e34 A T 11: 73,778,843 (GRCm39) Y118* probably null Het
Or3a10 A G 11: 73,935,873 (GRCm39) C76R possibly damaging Het
Or6c209 T A 10: 129,483,218 (GRCm39) C74S probably damaging Het
Or6d15 T A 6: 116,559,617 (GRCm39) I97L probably benign Het
Plin4 T A 17: 56,413,567 (GRCm39) T353S probably damaging Het
Ppp1r9a A G 6: 5,115,357 (GRCm39) T827A probably benign Het
Prlr C T 15: 10,317,652 (GRCm39) T40I probably damaging Het
Psme3 T C 11: 101,210,730 (GRCm39) probably benign Het
Pygb A T 2: 150,657,626 (GRCm39) D363V probably benign Het
Rsph6a C T 7: 18,788,871 (GRCm39) Q68* probably null Het
Serpini2 A G 3: 75,165,445 (GRCm39) V178A probably benign Het
Sh2d2a T C 3: 87,759,195 (GRCm39) probably benign Het
Skint7 A C 4: 111,837,395 (GRCm39) M58L probably benign Het
Slco3a1 G T 7: 73,970,301 (GRCm39) Y435* probably null Het
Stk17b T C 1: 53,801,742 (GRCm39) probably benign Het
Tinag T A 9: 76,938,992 (GRCm39) H162L possibly damaging Het
Ttc21a T A 9: 119,787,865 (GRCm39) L811Q probably damaging Het
Ttc41 A T 10: 86,594,961 (GRCm39) M912L probably benign Het
Washc5 C T 15: 59,213,942 (GRCm39) C838Y possibly damaging Het
Wrnip1 A G 13: 32,990,796 (GRCm39) T352A probably damaging Het
Zan A C 5: 137,394,439 (GRCm39) C4467G unknown Het
Zc3h7a T C 16: 10,970,197 (GRCm39) probably benign Het
Zfp729a C A 13: 67,768,345 (GRCm39) C628F probably benign Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19,286,007 (GRCm39) splice site probably benign
IGL01296:Vmn2r98 APN 17 19,285,447 (GRCm39) missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19,286,020 (GRCm39) missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19,285,521 (GRCm39) missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19,286,713 (GRCm39) missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19,286,548 (GRCm39) missense probably benign
IGL02123:Vmn2r98 APN 17 19,300,941 (GRCm39) missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19,286,113 (GRCm39) missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19,286,083 (GRCm39) missense probably benign
IGL02650:Vmn2r98 APN 17 19,301,223 (GRCm39) missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19,285,521 (GRCm39) missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19,286,275 (GRCm39) missense probably benign
IGL02807:Vmn2r98 APN 17 19,301,283 (GRCm39) missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19,286,242 (GRCm39) missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19,290,107 (GRCm39) missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19,301,223 (GRCm39) missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19,286,662 (GRCm39) missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19,286,089 (GRCm39) nonsense probably null
R0635:Vmn2r98 UTSW 17 19,300,759 (GRCm39) missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19,300,782 (GRCm39) missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19,301,011 (GRCm39) missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19,286,210 (GRCm39) missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19,285,440 (GRCm39) missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19,301,170 (GRCm39) missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19,286,702 (GRCm39) missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19,286,680 (GRCm39) missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19,285,595 (GRCm39) nonsense probably null
R2165:Vmn2r98 UTSW 17 19,301,553 (GRCm39) missense unknown
R2238:Vmn2r98 UTSW 17 19,286,213 (GRCm39) missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19,300,698 (GRCm39) missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19,286,081 (GRCm39) missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19,301,439 (GRCm39) missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19,287,664 (GRCm39) missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19,300,887 (GRCm39) missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19,286,354 (GRCm39) missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19,290,007 (GRCm39) missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19,286,602 (GRCm39) missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19,286,419 (GRCm39) missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19,286,306 (GRCm39) missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19,273,815 (GRCm39) missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19,300,981 (GRCm39) missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19,290,016 (GRCm39) nonsense probably null
R5371:Vmn2r98 UTSW 17 19,290,015 (GRCm39) missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19,301,161 (GRCm39) missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19,286,260 (GRCm39) missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19,286,336 (GRCm39) missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19,286,143 (GRCm39) missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19,286,063 (GRCm39) missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19,285,510 (GRCm39) missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19,286,530 (GRCm39) missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19,301,184 (GRCm39) missense probably benign
R7068:Vmn2r98 UTSW 17 19,285,575 (GRCm39) missense probably benign
R7607:Vmn2r98 UTSW 17 19,287,570 (GRCm39) missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19,300,797 (GRCm39) missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19,287,460 (GRCm39) splice site probably null
R7915:Vmn2r98 UTSW 17 19,287,493 (GRCm39) missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19,273,912 (GRCm39) missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19,301,425 (GRCm39) missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19,301,031 (GRCm39) missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19,286,532 (GRCm39) missense probably benign
R8952:Vmn2r98 UTSW 17 19,285,531 (GRCm39) missense possibly damaging 0.76
R9147:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19,301,481 (GRCm39) missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19,286,777 (GRCm39) missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19,287,517 (GRCm39) missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19,301,496 (GRCm39) missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19,285,665 (GRCm39) missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19,287,685 (GRCm39) nonsense probably null
Z1177:Vmn2r98 UTSW 17 19,285,398 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTATTTGTTCTGCATCAAGCAGACCC -3'
(R):5'- GCTGCATGTGACACACATAACCTCTTC -3'

Sequencing Primer
(F):5'- GCAGACCCTTGATCTAATAGGATG -3'
(R):5'- AGTGAACTCAGTTCAAGTTTCG -3'
Posted On 2013-06-11