Incidental Mutation 'R0545:Vmn2r98'
ID44791
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Namevomeronasal 2, receptor 98
SynonymsEG224552
MMRRC Submission 038737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R0545 (G1)
Quality Score203
Status Validated
Chromosome17
Chromosomal Location19053460-19082411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19053613 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 41 (V41F)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: V41F

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: V41F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,542,376 R76H probably damaging Het
4932438A13Rik G A 3: 36,987,690 probably benign Het
Adnp2 T C 18: 80,129,401 I598V probably benign Het
Ago3 T C 4: 126,417,232 N63D probably damaging Het
Alkbh7 C T 17: 56,999,012 R138* probably null Het
Atp6ap1l T C 13: 90,883,663 H300R probably benign Het
BC051076 C T 5: 87,963,490 noncoding transcript Het
Bpifb9a T A 2: 154,261,950 C104* probably null Het
Cacna2d2 T C 9: 107,525,223 L826P probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Ccdc88c T C 12: 100,947,188 D526G probably damaging Het
Cdh23 T A 10: 60,331,291 T1861S probably benign Het
Ces2f A C 8: 104,950,036 M121L possibly damaging Het
Cfap58 G A 19: 47,941,097 probably benign Het
Chpf2 T C 5: 24,590,324 S282P possibly damaging Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Cma2 A T 14: 55,973,113 M86L probably benign Het
Cog6 A T 3: 52,996,075 M134K probably damaging Het
Col1a1 A G 11: 94,951,594 D1446G unknown Het
Cpne8 T A 15: 90,497,075 D512V probably damaging Het
Ctnna2 T A 6: 77,605,182 N352I probably damaging Het
Cyp2c69 A C 19: 39,886,661 L16R probably damaging Het
Dysf T C 6: 84,099,461 S603P probably damaging Het
Epha5 A G 5: 84,067,358 probably null Het
Ercc3 T C 18: 32,245,902 S270P probably damaging Het
F10 T A 8: 13,048,249 C151S probably damaging Het
Gpr180 T G 14: 118,160,046 H317Q possibly damaging Het
Gstp2 T C 19: 4,041,633 E32G possibly damaging Het
Ikzf5 T C 7: 131,392,500 T133A possibly damaging Het
Itch G T 2: 155,182,298 G274* probably null Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Lama3 T A 18: 12,561,701 S1295T possibly damaging Het
Lipc A G 9: 70,812,705 L255P probably damaging Het
Lrrc38 A G 4: 143,350,758 D197G probably benign Het
Mfap2 A G 4: 141,014,185 probably benign Het
Mfhas1 A G 8: 35,589,048 K226E probably damaging Het
Morc1 A G 16: 48,565,657 R548G probably benign Het
Mrgprb5 T C 7: 48,168,885 N34S probably benign Het
Mroh4 T C 15: 74,625,427 T182A probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo5a T C 9: 75,167,037 F743L possibly damaging Het
Notch4 A C 17: 34,583,433 D1276A probably damaging Het
Olfr139 A G 11: 74,045,047 C76R possibly damaging Het
Olfr215 T A 6: 116,582,656 I97L probably benign Het
Olfr394 A T 11: 73,888,017 Y118* probably null Het
Olfr799 T A 10: 129,647,349 C74S probably damaging Het
Plin4 T A 17: 56,106,567 T353S probably damaging Het
Ppp1r9a A G 6: 5,115,357 T827A probably benign Het
Prlr C T 15: 10,317,566 T40I probably damaging Het
Psme3 T C 11: 101,319,904 probably benign Het
Pygb A T 2: 150,815,706 D363V probably benign Het
Rsph6a C T 7: 19,054,946 Q68* probably null Het
Serpini2 A G 3: 75,258,138 V178A probably benign Het
Sh2d2a T C 3: 87,851,888 probably benign Het
Skint7 A C 4: 111,980,198 M58L probably benign Het
Slco3a1 G T 7: 74,320,553 Y435* probably null Het
Stk17b T C 1: 53,762,583 probably benign Het
Tinag T A 9: 77,031,710 H162L possibly damaging Het
Ttc21a T A 9: 119,958,799 L811Q probably damaging Het
Ttc41 A T 10: 86,759,097 M912L probably benign Het
Washc5 C T 15: 59,342,093 C838Y possibly damaging Het
Wrnip1 A G 13: 32,806,813 T352A probably damaging Het
Zan A C 5: 137,396,177 C4467G unknown Het
Zc3h7a T C 16: 11,152,333 probably benign Het
Zfp729a C A 13: 67,620,226 C628F probably benign Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
R7607:Vmn2r98 UTSW 17 19067308 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACTATTTGTTCTGCATCAAGCAGACCC -3'
(R):5'- GCTGCATGTGACACACATAACCTCTTC -3'

Sequencing Primer
(F):5'- GCAGACCCTTGATCTAATAGGATG -3'
(R):5'- AGTGAACTCAGTTCAAGTTTCG -3'
Posted On2013-06-11