Incidental Mutation 'R5784:Myh6'
ID447932
Institutional Source Beutler Lab
Gene Symbol Myh6
Ensembl Gene ENSMUSG00000040752
Gene Namemyosin, heavy polypeptide 6, cardiac muscle, alpha
Synonymsalpha myosin, A830009F23Rik, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, Myhc-a, alpha-MHC
MMRRC Submission 043381-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5784 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54941921-54966927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54953064 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 999 (K999E)
Ref Sequence ENSEMBL: ENSMUSP00000154634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081857] [ENSMUST00000226297]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081857
AA Change: K999E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080538
Gene: ENSMUSG00000040752
AA Change: K999E

DomainStartEndE-ValueType
Pfam:Myosin_N 34 73 1.9e-15 PFAM
MYSc 79 781 N/A SMART
IQ 782 804 1.15e-1 SMART
IQ 808 830 3.32e2 SMART
Pfam:Myosin_tail_1 845 1926 2.1e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131892
Predicted Effect possibly damaging
Transcript: ENSMUST00000145322
AA Change: K999E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115326
Gene: ENSMUSG00000040752
AA Change: K999E

DomainStartEndE-ValueType
Pfam:Myosin_N 34 75 5.3e-17 PFAM
MYSc 79 781 N/A SMART
IQ 782 804 1.15e-1 SMART
IQ 808 830 3.32e2 SMART
coiled coil region 842 1112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000226297
AA Change: K999E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1280 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cardiac muscle myosin is a hexamer consisting of two heavy chain subunits, two light chain subunits, and two regulatory subunits. This gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located approximately 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. Mutations in this gene cause familial hypertrophic cardiomyopathy and atrial septal defect 3. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality associated with heart defects while heterozygotes show cardiac myofibrillar disarray, cardiac dysfunction and fibrosis. Mice heterozygous for different knock-in alleles may develop hypertrophic or dilated forms of cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,607 R292G possibly damaging Het
4932416K20Rik T A 8: 104,797,629 noncoding transcript Het
Aox3 A G 1: 58,153,499 D544G probably benign Het
Atg2a C A 19: 6,261,505 A1830D probably damaging Het
Casp1 T C 9: 5,299,337 I22T probably damaging Het
Ccdc141 A C 2: 77,029,327 L990W probably damaging Het
Cnbd2 A G 2: 156,338,657 T125A probably damaging Het
Cnep1r1 T A 8: 88,130,726 probably benign Het
Dhx38 G T 8: 109,559,613 Y348* probably null Het
Dnah7c A T 1: 46,524,068 I593L possibly damaging Het
Dpep3 T C 8: 105,978,743 D125G probably benign Het
Epb41l4b A C 4: 57,086,003 S191A probably damaging Het
Etl4 A G 2: 20,806,205 Y1033C possibly damaging Het
Fam193a T C 5: 34,466,223 L32P probably damaging Het
Gm8332 T A 12: 88,249,755 N116Y probably damaging Het
Grin2c T C 11: 115,258,295 E159G possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdhd2 A T 18: 76,967,145 D205V probably damaging Het
Helz T A 11: 107,670,481 N774K unknown Het
Idh3b A G 2: 130,279,671 V71A probably damaging Het
Lars T C 18: 42,219,899 M818V probably benign Het
Ltbp2 A G 12: 84,868,739 V162A probably damaging Het
Ltk G A 2: 119,754,359 Q136* probably null Het
Mafb A T 2: 160,366,541 C46S probably damaging Het
Map1s T C 8: 70,914,358 S636P probably damaging Het
Map3k13 A G 16: 21,898,641 K209E possibly damaging Het
Mppe1 T C 18: 67,228,027 N220D probably benign Het
Mydgf T C 17: 56,178,254 probably benign Het
Nemp1 T A 10: 127,677,198 V34D possibly damaging Het
Npr2 A G 4: 43,632,801 E206G probably benign Het
Olfr1497 A T 19: 13,795,346 H88Q probably benign Het
Olfr248 G A 1: 174,391,399 C110Y probably damaging Het
Olfr309 T C 7: 86,306,535 N193D probably damaging Het
Papln A G 12: 83,781,980 N820S probably benign Het
Pcdh10 T G 3: 45,380,640 F463C probably damaging Het
Pde7a A G 3: 19,264,845 V12A probably benign Het
Radil G T 5: 142,487,513 H804Q possibly damaging Het
Rbfox1 A T 16: 7,224,339 D39V probably damaging Het
Rims2 T G 15: 39,535,987 probably null Het
Rnf121 A G 7: 102,035,376 F110S probably benign Het
Saxo2 C T 7: 82,634,874 V259I probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc2a3 A T 6: 122,735,417 probably null Het
Traf2 A T 2: 25,539,037 V6E probably benign Het
Trim43c A T 9: 88,847,643 N379I probably benign Het
Ubr4 C G 4: 139,425,218 C1973W probably damaging Het
Unc13a G T 8: 71,655,666 D514E possibly damaging Het
Wdr27 T A 17: 14,926,233 T167S probably damaging Het
Zfp174 A T 16: 3,854,574 E329V probably benign Het
Zfp422 A T 6: 116,626,810 I76N probably damaging Het
Other mutations in Myh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Myh6 APN 14 54946993 missense probably benign 0.13
IGL00401:Myh6 APN 14 54953417 missense probably benign 0.00
IGL01062:Myh6 APN 14 54952292 missense probably damaging 0.99
IGL01300:Myh6 APN 14 54963091 missense possibly damaging 0.94
IGL01688:Myh6 APN 14 54963960 missense possibly damaging 0.74
IGL01695:Myh6 APN 14 54957413 missense probably benign 0.01
IGL01762:Myh6 APN 14 54962081 missense probably benign 0.17
IGL01803:Myh6 APN 14 54944543 missense probably damaging 1.00
IGL02079:Myh6 APN 14 54950541 missense probably damaging 1.00
IGL02315:Myh6 APN 14 54953834 missense probably damaging 1.00
IGL02340:Myh6 APN 14 54957155 missense possibly damaging 0.76
IGL02377:Myh6 APN 14 54944318 missense probably benign 0.10
IGL02715:Myh6 APN 14 54946908 unclassified probably benign
IGL02742:Myh6 APN 14 54953924 missense possibly damaging 0.62
P0028:Myh6 UTSW 14 54963637 missense probably benign
PIT4520001:Myh6 UTSW 14 54950124 missense probably benign 0.00
R0058:Myh6 UTSW 14 54963404 missense probably damaging 1.00
R0090:Myh6 UTSW 14 54958704 missense probably damaging 0.97
R0360:Myh6 UTSW 14 54948347 nonsense probably null
R0364:Myh6 UTSW 14 54948347 nonsense probably null
R0395:Myh6 UTSW 14 54946320 missense possibly damaging 0.94
R0549:Myh6 UTSW 14 54958608 missense probably damaging 1.00
R0559:Myh6 UTSW 14 54958554 missense probably benign
R0800:Myh6 UTSW 14 54953278 splice site probably benign
R0892:Myh6 UTSW 14 54947054 missense probably benign 0.17
R0975:Myh6 UTSW 14 54953369 missense probably damaging 1.00
R1051:Myh6 UTSW 14 54949527 missense probably benign 0.12
R1180:Myh6 UTSW 14 54944468 missense possibly damaging 0.93
R1311:Myh6 UTSW 14 54946365 missense probably damaging 0.96
R1490:Myh6 UTSW 14 54962718 nonsense probably null
R1531:Myh6 UTSW 14 54956506 missense probably damaging 1.00
R1835:Myh6 UTSW 14 54957401 missense probably benign 0.03
R1845:Myh6 UTSW 14 54944674 missense probably damaging 1.00
R2033:Myh6 UTSW 14 54963645 missense probably benign 0.00
R2143:Myh6 UTSW 14 54952954 missense probably damaging 1.00
R2146:Myh6 UTSW 14 54953771 missense probably damaging 1.00
R2155:Myh6 UTSW 14 54953794 missense probably benign
R2484:Myh6 UTSW 14 54961242 nonsense probably null
R3155:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3156:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3780:Myh6 UTSW 14 54963958 missense probably benign 0.00
R3906:Myh6 UTSW 14 54956955 missense probably benign 0.04
R3937:Myh6 UTSW 14 54963055 missense probably benign 0.00
R3938:Myh6 UTSW 14 54963055 missense probably benign 0.00
R4236:Myh6 UTSW 14 54960362 missense probably benign 0.15
R4373:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4374:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4377:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4798:Myh6 UTSW 14 54953293 missense probably damaging 1.00
R4844:Myh6 UTSW 14 54947194 missense possibly damaging 0.89
R4908:Myh6 UTSW 14 54956962 missense probably damaging 1.00
R5256:Myh6 UTSW 14 54952661 missense probably damaging 1.00
R5277:Myh6 UTSW 14 54956562 missense probably benign 0.01
R5356:Myh6 UTSW 14 54953762 missense probably damaging 1.00
R5433:Myh6 UTSW 14 54953924 missense probably benign 0.32
R5616:Myh6 UTSW 14 54956581 missense probably benign 0.17
R5820:Myh6 UTSW 14 54958680 missense probably damaging 0.99
R5835:Myh6 UTSW 14 54950407 missense probably damaging 1.00
R5922:Myh6 UTSW 14 54946474 missense probably damaging 0.99
R5975:Myh6 UTSW 14 54950508 missense probably benign 0.31
R5988:Myh6 UTSW 14 54965394 missense probably damaging 1.00
R6630:Myh6 UTSW 14 54942001 missense probably benign 0.01
R6845:Myh6 UTSW 14 54944749 missense probably benign
R7009:Myh6 UTSW 14 54952292 missense probably damaging 0.99
R7154:Myh6 UTSW 14 54960307 missense probably benign 0.43
R7293:Myh6 UTSW 14 54947174 missense probably benign 0.00
R7313:Myh6 UTSW 14 54960270 missense probably benign 0.00
R7339:Myh6 UTSW 14 54961568 intron probably null
R7348:Myh6 UTSW 14 54952259 missense probably damaging 1.00
R7487:Myh6 UTSW 14 54953496 nonsense probably null
R7680:Myh6 UTSW 14 54948733 missense possibly damaging 0.88
R7726:Myh6 UTSW 14 54965365 missense probably damaging 0.99
R7743:Myh6 UTSW 14 54957150 missense probably damaging 0.99
R7807:Myh6 UTSW 14 54942440 missense probably damaging 1.00
Z1088:Myh6 UTSW 14 54956997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAGAACAGAGAAGCTCCTG -3'
(R):5'- TATCGGCCTAGTTGGTAGCATC -3'

Sequencing Primer
(F):5'- GGGAAACTCCTTCTCTATAGGCG -3'
(R):5'- ATCGGCCTAGTTGGTAGCATCTATAC -3'
Posted On2016-12-15