Incidental Mutation 'R5784:Map3k13'
ID 447936
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Name mitogen-activated protein kinase kinase kinase 13
Synonyms C130026N12Rik
MMRRC Submission 043381-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5784 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 21643923-21752189 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21717391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 209 (K209E)
Ref Sequence ENSEMBL: ENSMUSP00000156202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]
AlphaFold Q1HKZ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000042065
AA Change: K209E

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: K209E

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171547
Predicted Effect possibly damaging
Transcript: ENSMUST00000231988
AA Change: K209E

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232240
AA Change: K209E

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1817 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 78,903,441 (GRCm39) R292G possibly damaging Het
4932416K20Rik T A 8: 105,524,261 (GRCm39) noncoding transcript Het
Aox3 A G 1: 58,192,658 (GRCm39) D544G probably benign Het
Atg2a C A 19: 6,311,535 (GRCm39) A1830D probably damaging Het
Casp1 T C 9: 5,299,337 (GRCm39) I22T probably damaging Het
Ccdc141 A C 2: 76,859,671 (GRCm39) L990W probably damaging Het
Cnbd2 A G 2: 156,180,577 (GRCm39) T125A probably damaging Het
Cnep1r1 T A 8: 88,857,354 (GRCm39) probably benign Het
Dhx38 G T 8: 110,286,245 (GRCm39) Y348* probably null Het
Dnah7c A T 1: 46,563,228 (GRCm39) I593L possibly damaging Het
Dpep3 T C 8: 106,705,375 (GRCm39) D125G probably benign Het
Eif1ad10 T A 12: 88,216,525 (GRCm39) N116Y probably damaging Het
Epb41l4b A C 4: 57,086,003 (GRCm39) S191A probably damaging Het
Etl4 A G 2: 20,811,016 (GRCm39) Y1033C possibly damaging Het
Fam193a T C 5: 34,623,567 (GRCm39) L32P probably damaging Het
Grin2c T C 11: 115,149,121 (GRCm39) E159G possibly damaging Het
Gtf2h3 C T 5: 124,722,360 (GRCm39) T121I probably benign Het
Hdhd2 A T 18: 77,054,841 (GRCm39) D205V probably damaging Het
Helz T A 11: 107,561,307 (GRCm39) N774K unknown Het
Idh3b A G 2: 130,121,591 (GRCm39) V71A probably damaging Het
Lars1 T C 18: 42,352,964 (GRCm39) M818V probably benign Het
Ltbp2 A G 12: 84,915,513 (GRCm39) V162A probably damaging Het
Ltk G A 2: 119,584,840 (GRCm39) Q136* probably null Het
Mafb A T 2: 160,208,461 (GRCm39) C46S probably damaging Het
Map1s T C 8: 71,367,002 (GRCm39) S636P probably damaging Het
Mppe1 T C 18: 67,361,098 (GRCm39) N220D probably benign Het
Mydgf T C 17: 56,485,254 (GRCm39) probably benign Het
Myh6 T C 14: 55,190,521 (GRCm39) K999E possibly damaging Het
Nemp1 T A 10: 127,513,067 (GRCm39) V34D possibly damaging Het
Npr2 A G 4: 43,632,801 (GRCm39) E206G probably benign Het
Or10x4 G A 1: 174,218,965 (GRCm39) C110Y probably damaging Het
Or13g1 T C 7: 85,955,743 (GRCm39) N193D probably damaging Het
Or9q2 A T 19: 13,772,710 (GRCm39) H88Q probably benign Het
Papln A G 12: 83,828,754 (GRCm39) N820S probably benign Het
Pcdh10 T G 3: 45,335,075 (GRCm39) F463C probably damaging Het
Pde7a A G 3: 19,319,009 (GRCm39) V12A probably benign Het
Radil G T 5: 142,473,268 (GRCm39) H804Q possibly damaging Het
Rbfox1 A T 16: 7,042,203 (GRCm39) D39V probably damaging Het
Rims2 T G 15: 39,399,383 (GRCm39) probably null Het
Rnf121 A G 7: 101,684,583 (GRCm39) F110S probably benign Het
Saxo2 C T 7: 82,284,082 (GRCm39) V259I probably benign Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc2a3 A T 6: 122,712,376 (GRCm39) probably null Het
Traf2 A T 2: 25,429,049 (GRCm39) V6E probably benign Het
Trim43c A T 9: 88,729,696 (GRCm39) N379I probably benign Het
Ubr4 C G 4: 139,152,529 (GRCm39) C1973W probably damaging Het
Unc13a G T 8: 72,108,310 (GRCm39) D514E possibly damaging Het
Wdr27 T A 17: 15,146,495 (GRCm39) T167S probably damaging Het
Zfp174 A T 16: 3,672,438 (GRCm39) E329V probably benign Het
Zfp422 A T 6: 116,603,771 (GRCm39) I76N probably damaging Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21,740,514 (GRCm39) missense probably benign 0.00
IGL01092:Map3k13 APN 16 21,746,766 (GRCm39) missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21,710,873 (GRCm39) missense probably benign
IGL02444:Map3k13 APN 16 21,732,982 (GRCm39) missense probably benign 0.19
IGL02503:Map3k13 APN 16 21,727,454 (GRCm39) missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21,724,005 (GRCm39) missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21,710,981 (GRCm39) missense possibly damaging 0.94
R0086:Map3k13 UTSW 16 21,732,975 (GRCm39) missense probably damaging 0.98
R0124:Map3k13 UTSW 16 21,722,506 (GRCm39) missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21,732,907 (GRCm39) missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21,710,738 (GRCm39) missense probably benign
R0601:Map3k13 UTSW 16 21,723,999 (GRCm39) missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21,725,274 (GRCm39) missense probably benign 0.03
R0918:Map3k13 UTSW 16 21,744,990 (GRCm39) missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21,722,542 (GRCm39) missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21,732,939 (GRCm39) missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21,729,836 (GRCm39) missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21,710,894 (GRCm39) missense probably benign 0.01
R2332:Map3k13 UTSW 16 21,717,427 (GRCm39) splice site probably null
R2361:Map3k13 UTSW 16 21,725,286 (GRCm39) missense probably benign 0.05
R4395:Map3k13 UTSW 16 21,717,321 (GRCm39) missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4506:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4521:Map3k13 UTSW 16 21,724,525 (GRCm39) missense possibly damaging 0.94
R4753:Map3k13 UTSW 16 21,710,752 (GRCm39) missense probably benign
R4952:Map3k13 UTSW 16 21,729,769 (GRCm39) missense probably benign 0.15
R5035:Map3k13 UTSW 16 21,740,421 (GRCm39) missense probably benign 0.03
R5327:Map3k13 UTSW 16 21,740,397 (GRCm39) missense possibly damaging 0.89
R5831:Map3k13 UTSW 16 21,746,798 (GRCm39) makesense probably null
R5996:Map3k13 UTSW 16 21,723,995 (GRCm39) missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21,723,933 (GRCm39) missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21,740,527 (GRCm39) missense probably benign 0.15
R6620:Map3k13 UTSW 16 21,711,061 (GRCm39) missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21,711,062 (GRCm39) missense probably benign 0.32
R6692:Map3k13 UTSW 16 21,723,987 (GRCm39) missense possibly damaging 0.66
R6695:Map3k13 UTSW 16 21,741,028 (GRCm39) missense probably benign 0.10
R6743:Map3k13 UTSW 16 21,711,173 (GRCm39) missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21,741,013 (GRCm39) missense probably benign 0.00
R6965:Map3k13 UTSW 16 21,740,900 (GRCm39) missense probably benign
R7149:Map3k13 UTSW 16 21,744,187 (GRCm39) missense probably benign 0.04
R7174:Map3k13 UTSW 16 21,745,006 (GRCm39) missense probably damaging 1.00
R7256:Map3k13 UTSW 16 21,710,988 (GRCm39) missense probably benign 0.03
R7400:Map3k13 UTSW 16 21,741,072 (GRCm39) missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21,740,436 (GRCm39) missense probably damaging 1.00
R7848:Map3k13 UTSW 16 21,724,621 (GRCm39) missense probably damaging 0.98
R7871:Map3k13 UTSW 16 21,740,346 (GRCm39) missense probably benign 0.09
R7876:Map3k13 UTSW 16 21,741,069 (GRCm39) missense probably benign 0.00
R8002:Map3k13 UTSW 16 21,723,878 (GRCm39) missense probably benign 0.05
R8089:Map3k13 UTSW 16 21,722,567 (GRCm39) missense possibly damaging 0.48
R8341:Map3k13 UTSW 16 21,740,334 (GRCm39) nonsense probably null
R8738:Map3k13 UTSW 16 21,745,008 (GRCm39) missense probably damaging 1.00
R8940:Map3k13 UTSW 16 21,727,454 (GRCm39) missense possibly damaging 0.50
R8949:Map3k13 UTSW 16 21,723,882 (GRCm39) missense probably benign 0.05
R9391:Map3k13 UTSW 16 21,740,665 (GRCm39) missense probably benign 0.00
R9749:Map3k13 UTSW 16 21,740,581 (GRCm39) missense probably benign 0.00
R9802:Map3k13 UTSW 16 21,740,518 (GRCm39) missense possibly damaging 0.85
Z1176:Map3k13 UTSW 16 21,723,912 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCCTGTAGAATGGTCTCAG -3'
(R):5'- AGCCCTATTTCTCTAAAACCAGTCC -3'

Sequencing Primer
(F):5'- GCCTGTAGAATGGTCTCAGCAAATTC -3'
(R):5'- GTCCGTAAACAAAGCTGTCC -3'
Posted On 2016-12-15