Incidental Mutation 'R5785:Ndufa10'
ID447944
Institutional Source Beutler Lab
Gene Symbol Ndufa10
Ensembl Gene ENSMUSG00000026260
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex 10
Synonyms
MMRRC Submission 043206-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5785 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location92439010-92473860 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 92460374 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027478] [ENSMUST00000189503]
Predicted Effect probably null
Transcript: ENSMUST00000027478
SMART Domains Protein: ENSMUSP00000027478
Gene: ENSMUSG00000026260

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:dNK 60 287 2.4e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187141
Predicted Effect probably benign
Transcript: ENSMUST00000189503
SMART Domains Protein: ENSMUSP00000140576
Gene: ENSMUSG00000026260

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of 42 kDa complex I, the first enzyme complex in the electron transport chain of mitochondria. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. A mutation in this gene was found in an individual with Leigh syndrome. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A T 9: 99,620,672 N295I probably damaging Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Apbb1 C A 7: 105,567,715 D254Y probably damaging Het
Arhgap39 T C 15: 76,737,418 M328V probably benign Het
Bub1b T A 2: 118,609,844 V143D probably damaging Het
Celsr3 A G 9: 108,827,797 D493G probably damaging Het
Cers4 T A 8: 4,516,992 probably null Het
Clec4d A G 6: 123,274,770 R204G probably benign Het
Cngb1 C A 8: 95,254,195 R910L possibly damaging Het
Coro2a A T 4: 46,564,691 N18K probably benign Het
Cwf19l1 A G 19: 44,121,941 F290S probably damaging Het
Esp18 C T 17: 39,409,948 T28I probably damaging Het
Hdac10 A T 15: 89,126,945 F205Y probably benign Het
Hhip T A 8: 79,998,192 H317L possibly damaging Het
Il1f8 G A 2: 24,154,649 M20I probably benign Het
Ilf3 T A 9: 21,394,872 N276K probably damaging Het
Jchain T C 5: 88,522,517 N81S probably benign Het
Mei4 A G 9: 82,025,547 Y211C probably damaging Het
Mx2 A T 16: 97,538,704 E20V possibly damaging Het
Nodal A G 10: 61,423,677 T298A probably damaging Het
Nvl T C 1: 181,139,298 Y47C probably damaging Het
Olfr1500 T C 19: 13,827,619 Y259C probably damaging Het
Onecut1 C T 9: 74,863,392 R366C probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp5c A G 7: 17,027,691 probably null Het
Prag1 A G 8: 36,103,487 E408G probably benign Het
Ptpn21 T C 12: 98,682,550 N949S probably damaging Het
Scn7a A C 2: 66,697,568 N859K possibly damaging Het
Smarca4 T C 9: 21,686,026 I1362T probably damaging Het
Syt12 T C 19: 4,450,994 R343G possibly damaging Het
Topbp1 T C 9: 103,323,528 S587P probably benign Het
Trim80 C T 11: 115,446,475 Q388* probably null Het
Tsc2 T C 17: 24,599,887 probably null Het
Vmn2r3 T A 3: 64,259,023 T896S possibly damaging Het
Vmn2r-ps130 T A 17: 23,061,487 S41T probably benign Het
Xirp2 A G 2: 67,509,662 E749G probably damaging Het
Zbtb24 G A 10: 41,451,853 G245E probably benign Het
Zfp507 A G 7: 35,787,742 V767A probably benign Het
Other mutations in Ndufa10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02793:Ndufa10 APN 1 92469917 missense probably damaging 1.00
IGL03116:Ndufa10 APN 1 92464387 nonsense probably null
R0136:Ndufa10 UTSW 1 92463128 nonsense probably null
R0627:Ndufa10 UTSW 1 92469896 missense probably damaging 1.00
R2024:Ndufa10 UTSW 1 92439892 missense probably damaging 0.99
R2025:Ndufa10 UTSW 1 92439892 missense probably damaging 0.99
R2026:Ndufa10 UTSW 1 92439892 missense probably damaging 0.99
R4694:Ndufa10 UTSW 1 92452102 missense probably benign 0.00
R4895:Ndufa10 UTSW 1 92469896 missense probably damaging 1.00
R5423:Ndufa10 UTSW 1 92462320 missense probably benign
R7011:Ndufa10 UTSW 1 92470859 missense probably damaging 0.99
R7383:Ndufa10 UTSW 1 92464461 missense probably damaging 0.98
R7868:Ndufa10 UTSW 1 92460447 missense probably damaging 0.99
R7951:Ndufa10 UTSW 1 92460447 missense probably damaging 0.99
R8290:Ndufa10 UTSW 1 92463147 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- AATGTGCCTCTGCTGAGAG -3'
(R):5'- TGTATGATCTGCCAGGACTGTG -3'

Sequencing Primer
(F):5'- CAAATTACTATGTACAGCGAGTTGC -3'
(R):5'- TCTGCCAGGACTGTGTAAAC -3'
Posted On2016-12-15