Incidental Mutation 'R5785:Nvl'
ID 447946
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Name nuclear VCP-like
Synonyms 1200009I24Rik
MMRRC Submission 043206-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R5785 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 180914703-180971769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 180966863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 47 (Y47C)
Ref Sequence ENSEMBL: ENSMUSP00000027797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797]
AlphaFold Q9DBY8
PDB Structure Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000027797
AA Change: Y47C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516
AA Change: Y47C

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193758
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A T 9: 99,502,725 (GRCm39) N295I probably damaging Het
Abcg3 G A 5: 105,116,036 (GRCm39) A266V probably damaging Het
Apbb1 C A 7: 105,216,922 (GRCm39) D254Y probably damaging Het
Arhgap39 T C 15: 76,621,618 (GRCm39) M328V probably benign Het
Bub1b T A 2: 118,440,325 (GRCm39) V143D probably damaging Het
Celsr3 A G 9: 108,704,996 (GRCm39) D493G probably damaging Het
Cers4 T A 8: 4,566,992 (GRCm39) probably null Het
Clec4d A G 6: 123,251,729 (GRCm39) R204G probably benign Het
Cngb1 C A 8: 95,980,823 (GRCm39) R910L possibly damaging Het
Coro2a A T 4: 46,564,691 (GRCm39) N18K probably benign Het
Cwf19l1 A G 19: 44,110,380 (GRCm39) F290S probably damaging Het
Esp18 C T 17: 39,720,839 (GRCm39) T28I probably damaging Het
Hdac10 A T 15: 89,011,148 (GRCm39) F205Y probably benign Het
Hhip T A 8: 80,724,821 (GRCm39) H317L possibly damaging Het
Il36b G A 2: 24,044,661 (GRCm39) M20I probably benign Het
Ilf3 T A 9: 21,306,168 (GRCm39) N276K probably damaging Het
Jchain T C 5: 88,670,376 (GRCm39) N81S probably benign Het
Mei4 A G 9: 81,907,600 (GRCm39) Y211C probably damaging Het
Mx2 A T 16: 97,339,904 (GRCm39) E20V possibly damaging Het
Ndufa10 A G 1: 92,388,096 (GRCm39) probably null Het
Nodal A G 10: 61,259,456 (GRCm39) T298A probably damaging Het
Onecut1 C T 9: 74,770,674 (GRCm39) R366C probably damaging Het
Or9q1 T C 19: 13,804,983 (GRCm39) Y259C probably damaging Het
Plekha6 G C 1: 133,200,045 (GRCm39) R208P possibly damaging Het
Ppp5c A G 7: 16,761,616 (GRCm39) probably null Het
Prag1 A G 8: 36,570,641 (GRCm39) E408G probably benign Het
Ptpn21 T C 12: 98,648,809 (GRCm39) N949S probably damaging Het
Scn7a A C 2: 66,527,912 (GRCm39) N859K possibly damaging Het
Smarca4 T C 9: 21,597,322 (GRCm39) I1362T probably damaging Het
Syt12 T C 19: 4,501,022 (GRCm39) R343G possibly damaging Het
Topbp1 T C 9: 103,200,727 (GRCm39) S587P probably benign Het
Trim80 C T 11: 115,337,301 (GRCm39) Q388* probably null Het
Tsc2 T C 17: 24,818,861 (GRCm39) probably null Het
Vmn2r130 T A 17: 23,280,461 (GRCm39) S41T probably benign Het
Vmn2r3 T A 3: 64,166,444 (GRCm39) T896S possibly damaging Het
Xirp2 A G 2: 67,340,006 (GRCm39) E749G probably damaging Het
Zbtb24 G A 10: 41,327,849 (GRCm39) G245E probably benign Het
Zfp507 A G 7: 35,487,167 (GRCm39) V767A probably benign Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 180,932,690 (GRCm39) missense probably damaging 1.00
IGL00943:Nvl APN 1 180,929,199 (GRCm39) missense possibly damaging 0.72
IGL01956:Nvl APN 1 180,962,509 (GRCm39) missense probably benign 0.00
IGL02657:Nvl APN 1 180,934,541 (GRCm39) missense probably damaging 1.00
Nineveh UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
nubia UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
IGL03098:Nvl UTSW 1 180,921,471 (GRCm39) missense probably benign 0.37
P0047:Nvl UTSW 1 180,939,867 (GRCm39) missense probably damaging 1.00
R0003:Nvl UTSW 1 180,941,698 (GRCm39) missense probably damaging 1.00
R0114:Nvl UTSW 1 180,947,956 (GRCm39) missense probably benign 0.19
R0265:Nvl UTSW 1 180,962,395 (GRCm39) missense probably damaging 0.96
R0928:Nvl UTSW 1 180,921,467 (GRCm39) missense probably benign 0.00
R1398:Nvl UTSW 1 180,924,691 (GRCm39) splice site probably benign
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1529:Nvl UTSW 1 180,936,724 (GRCm39) critical splice donor site probably null
R1934:Nvl UTSW 1 180,926,693 (GRCm39) missense probably damaging 0.96
R2176:Nvl UTSW 1 180,962,639 (GRCm39) splice site probably benign
R2351:Nvl UTSW 1 180,958,357 (GRCm39) missense probably benign 0.03
R4415:Nvl UTSW 1 180,932,679 (GRCm39) missense probably benign
R4570:Nvl UTSW 1 180,971,647 (GRCm39) missense probably benign 0.03
R4720:Nvl UTSW 1 180,929,152 (GRCm39) missense probably damaging 1.00
R4888:Nvl UTSW 1 180,945,191 (GRCm39) missense probably damaging 1.00
R5026:Nvl UTSW 1 180,932,720 (GRCm39) missense probably damaging 1.00
R5507:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R5983:Nvl UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
R6143:Nvl UTSW 1 180,962,560 (GRCm39) missense probably benign 0.01
R6532:Nvl UTSW 1 180,971,708 (GRCm39) splice site probably null
R6821:Nvl UTSW 1 180,954,535 (GRCm39) nonsense probably null
R7062:Nvl UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
R7247:Nvl UTSW 1 180,939,851 (GRCm39) critical splice donor site probably null
R7358:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R7665:Nvl UTSW 1 180,962,509 (GRCm39) missense probably benign 0.18
R7795:Nvl UTSW 1 180,924,722 (GRCm39) missense probably benign 0.00
R7931:Nvl UTSW 1 180,936,720 (GRCm39) splice site probably benign
R8185:Nvl UTSW 1 180,971,739 (GRCm39) unclassified probably benign
R8806:Nvl UTSW 1 180,922,619 (GRCm39) missense probably benign 0.01
R8933:Nvl UTSW 1 180,966,638 (GRCm39) missense probably benign 0.00
R8975:Nvl UTSW 1 180,958,001 (GRCm39) missense probably benign
R9249:Nvl UTSW 1 180,962,593 (GRCm39) missense probably damaging 1.00
R9584:Nvl UTSW 1 180,958,431 (GRCm39) missense probably benign
R9586:Nvl UTSW 1 180,932,635 (GRCm39) critical splice donor site probably null
X0067:Nvl UTSW 1 180,966,723 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTGCCAGATGTCCATCTTCTAG -3'
(R):5'- AGCCAGTGTAATTGGGCTG -3'

Sequencing Primer
(F):5'- TGCTAAATACTGAAACAAGTG -3'
(R):5'- CTCAGGAAGCAGATGGATTTCTTAGC -3'
Posted On 2016-12-15