Incidental Mutation 'R5785:Il1f8'
ID447947
Institutional Source Beutler Lab
Gene Symbol Il1f8
Ensembl Gene ENSMUSG00000026985
Gene Nameinterleukin 1 family, member 8
Synonyms2310043N20Rik
MMRRC Submission 043206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5785 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location24153161-24160519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24154649 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 20 (M20I)
Ref Sequence ENSEMBL: ENSMUSP00000028363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028363]
Predicted Effect probably benign
Transcript: ENSMUST00000028363
AA Change: M20I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000028363
Gene: ENSMUSG00000026985
AA Change: M20I

DomainStartEndE-ValueType
IL1 33 180 3.19e-22 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. Protein structure modeling indicated that this cytokine may contain a 12-stranded beta-trefoil structure that is conserved between IL1A (IL-A alpha) and IL1B (IL-1 beta). This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A T 9: 99,620,672 N295I probably damaging Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Apbb1 C A 7: 105,567,715 D254Y probably damaging Het
Arhgap39 T C 15: 76,737,418 M328V probably benign Het
Bub1b T A 2: 118,609,844 V143D probably damaging Het
Celsr3 A G 9: 108,827,797 D493G probably damaging Het
Cers4 T A 8: 4,516,992 probably null Het
Clec4d A G 6: 123,274,770 R204G probably benign Het
Cngb1 C A 8: 95,254,195 R910L possibly damaging Het
Coro2a A T 4: 46,564,691 N18K probably benign Het
Cwf19l1 A G 19: 44,121,941 F290S probably damaging Het
Esp18 C T 17: 39,409,948 T28I probably damaging Het
Hdac10 A T 15: 89,126,945 F205Y probably benign Het
Hhip T A 8: 79,998,192 H317L possibly damaging Het
Ilf3 T A 9: 21,394,872 N276K probably damaging Het
Jchain T C 5: 88,522,517 N81S probably benign Het
Mei4 A G 9: 82,025,547 Y211C probably damaging Het
Mx2 A T 16: 97,538,704 E20V possibly damaging Het
Ndufa10 A G 1: 92,460,374 probably null Het
Nodal A G 10: 61,423,677 T298A probably damaging Het
Nvl T C 1: 181,139,298 Y47C probably damaging Het
Olfr1500 T C 19: 13,827,619 Y259C probably damaging Het
Onecut1 C T 9: 74,863,392 R366C probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp5c A G 7: 17,027,691 probably null Het
Prag1 A G 8: 36,103,487 E408G probably benign Het
Ptpn21 T C 12: 98,682,550 N949S probably damaging Het
Scn7a A C 2: 66,697,568 N859K possibly damaging Het
Smarca4 T C 9: 21,686,026 I1362T probably damaging Het
Syt12 T C 19: 4,450,994 R343G possibly damaging Het
Topbp1 T C 9: 103,323,528 S587P probably benign Het
Trim80 C T 11: 115,446,475 Q388* probably null Het
Tsc2 T C 17: 24,599,887 probably null Het
Vmn2r3 T A 3: 64,259,023 T896S possibly damaging Het
Vmn2r-ps130 T A 17: 23,061,487 S41T probably benign Het
Xirp2 A G 2: 67,509,662 E749G probably damaging Het
Zbtb24 G A 10: 41,451,853 G245E probably benign Het
Zfp507 A G 7: 35,787,742 V767A probably benign Het
Other mutations in Il1f8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Il1f8 APN 2 24159913 missense probably benign 0.00
IGL01944:Il1f8 APN 2 24155279 missense probably damaging 1.00
IGL02379:Il1f8 APN 2 24154638 missense probably benign 0.01
R0035:Il1f8 UTSW 2 24159878 missense probably benign 0.19
R0035:Il1f8 UTSW 2 24159878 missense probably benign 0.19
R2137:Il1f8 UTSW 2 24154660 missense probably benign 0.00
R2139:Il1f8 UTSW 2 24154660 missense probably benign 0.00
R4052:Il1f8 UTSW 2 24159832 missense probably damaging 1.00
R4096:Il1f8 UTSW 2 24158814 missense possibly damaging 0.66
R4705:Il1f8 UTSW 2 24154618 missense probably benign 0.00
R6541:Il1f8 UTSW 2 24159815 missense probably damaging 1.00
R7517:Il1f8 UTSW 2 24159878 missense probably benign 0.02
R7752:Il1f8 UTSW 2 24158814 missense possibly damaging 0.66
R7858:Il1f8 UTSW 2 24154614 missense probably benign 0.00
R8252:Il1f8 UTSW 2 24158813 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CACTTAGGGATTGCTGTCCTTG -3'
(R):5'- TAAGGCAAGAGCTAAGTGACTTC -3'

Sequencing Primer
(F):5'- AAGGTCAGGGTTCCAACTCTAGC -3'
(R):5'- GCAAGAGCTAAGTGACTTCACATTTC -3'
Posted On2016-12-15