Incidental Mutation 'R5785:Jchain'
ID447954
Institutional Source Beutler Lab
Gene Symbol Jchain
Ensembl Gene ENSMUSG00000067149
Gene Nameimmunoglobulin joining chain
SynonymsJ chain, 9530090F24Rik, Igj, Jch
MMRRC Submission 043206-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5785 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location88519809-88527891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88522517 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 81 (N81S)
Ref Sequence ENSEMBL: ENSMUSP00000084259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087033]
Predicted Effect probably benign
Transcript: ENSMUST00000087033
AA Change: N81S

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000084259
Gene: ENSMUSG00000067149
AA Change: N81S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_J_chain 23 159 6.3e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164073
SMART Domains Protein: ENSMUSP00000132955
Gene: ENSMUSG00000067149

DomainStartEndE-ValueType
Pfam:Ig_J_chain 1 119 1.3e-72 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show increased IgA level and alterations in IgA transport and in susceptibility to viral and parasitic infections. Homozygotes for another null allele show increased IgA level, decreased IgM level, reduced numbers of IgM plasma cells, and impaired IgM immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A T 9: 99,620,672 N295I probably damaging Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Apbb1 C A 7: 105,567,715 D254Y probably damaging Het
Arhgap39 T C 15: 76,737,418 M328V probably benign Het
Bub1b T A 2: 118,609,844 V143D probably damaging Het
Celsr3 A G 9: 108,827,797 D493G probably damaging Het
Cers4 T A 8: 4,516,992 probably null Het
Clec4d A G 6: 123,274,770 R204G probably benign Het
Cngb1 C A 8: 95,254,195 R910L possibly damaging Het
Coro2a A T 4: 46,564,691 N18K probably benign Het
Cwf19l1 A G 19: 44,121,941 F290S probably damaging Het
Esp18 C T 17: 39,409,948 T28I probably damaging Het
Hdac10 A T 15: 89,126,945 F205Y probably benign Het
Hhip T A 8: 79,998,192 H317L possibly damaging Het
Il1f8 G A 2: 24,154,649 M20I probably benign Het
Ilf3 T A 9: 21,394,872 N276K probably damaging Het
Mei4 A G 9: 82,025,547 Y211C probably damaging Het
Mx2 A T 16: 97,538,704 E20V possibly damaging Het
Ndufa10 A G 1: 92,460,374 probably null Het
Nodal A G 10: 61,423,677 T298A probably damaging Het
Nvl T C 1: 181,139,298 Y47C probably damaging Het
Olfr1500 T C 19: 13,827,619 Y259C probably damaging Het
Onecut1 C T 9: 74,863,392 R366C probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp5c A G 7: 17,027,691 probably null Het
Prag1 A G 8: 36,103,487 E408G probably benign Het
Ptpn21 T C 12: 98,682,550 N949S probably damaging Het
Scn7a A C 2: 66,697,568 N859K possibly damaging Het
Smarca4 T C 9: 21,686,026 I1362T probably damaging Het
Syt12 T C 19: 4,450,994 R343G possibly damaging Het
Topbp1 T C 9: 103,323,528 S587P probably benign Het
Trim80 C T 11: 115,446,475 Q388* probably null Het
Tsc2 T C 17: 24,599,887 probably null Het
Vmn2r3 T A 3: 64,259,023 T896S possibly damaging Het
Vmn2r-ps130 T A 17: 23,061,487 S41T probably benign Het
Xirp2 A G 2: 67,509,662 E749G probably damaging Het
Zbtb24 G A 10: 41,451,853 G245E probably benign Het
Zfp507 A G 7: 35,787,742 V767A probably benign Het
Other mutations in Jchain
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Jchain APN 5 88521524 missense probably damaging 1.00
R0403:Jchain UTSW 5 88521378 missense probably benign 0.01
R0718:Jchain UTSW 5 88526202 missense probably benign 0.00
R1470:Jchain UTSW 5 88526120 missense probably benign 0.21
R1470:Jchain UTSW 5 88526120 missense probably benign 0.21
R1987:Jchain UTSW 5 88521467 missense probably damaging 0.99
R3684:Jchain UTSW 5 88522539 missense probably damaging 1.00
R5010:Jchain UTSW 5 88522505 missense probably damaging 0.98
R6076:Jchain UTSW 5 88527772 missense probably benign
R6250:Jchain UTSW 5 88526175 missense probably benign 0.00
R6275:Jchain UTSW 5 88521353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGTCATTAGCCTAAGAATTGGTG -3'
(R):5'- TAGCCTGAGAAACCAACTAGTGTG -3'

Sequencing Primer
(F):5'- TCATTAGCCTAAGAATTGGTGTATTC -3'
(R):5'- CCTGAGAAACCAACTAGTGTGTAGAC -3'
Posted On2016-12-15