Incidental Mutation 'R0545:Ercc3'
ID 44796
Institutional Source Beutler Lab
Gene Symbol Ercc3
Ensembl Gene ENSMUSG00000024382
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 3
Synonyms XPB
MMRRC Submission 038737-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0545 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 32373357-32403206 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32378955 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 270 (S270P)
Ref Sequence ENSEMBL: ENSMUSP00000025241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025241]
AlphaFold P49135
Predicted Effect probably damaging
Transcript: ENSMUST00000025241
AA Change: S270P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025241
Gene: ENSMUSG00000024382
AA Change: S270P

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Pfam:Helicase_C_3 76 203 1.2e-46 PFAM
DEXDc 313 493 2.52e-18 SMART
HELICc 570 648 4.32e-8 SMART
low complexity region 707 716 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142213
Meta Mutation Damage Score 0.5595 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ATP-dependent DNA helicase that functions in nucleotide excision repair. The encoded protein is a subunit of basal transcription factor 2 (TFIIH) and, therefore, also functions in class II transcription. Mutations in this gene are associated with Xeroderma pigmentosum B, Cockayne's syndrome, and trichothiodystrophy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a frame shift mutation in exon 15 exhibit embryonic lethality prior to E8.5. Mice homozygous for a frame shift mutation following by a stop codon insertion in exon 15 exhibit increased sensitivity to ultraviolet- and gamma-irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,547,187 (GRCm39) R76H probably damaging Het
Adnp2 T C 18: 80,172,616 (GRCm39) I598V probably benign Het
Ago3 T C 4: 126,311,025 (GRCm39) N63D probably damaging Het
Alkbh7 C T 17: 57,306,012 (GRCm39) R138* probably null Het
Atp6ap1l T C 13: 91,031,782 (GRCm39) H300R probably benign Het
BC051076 C T 5: 88,111,349 (GRCm39) noncoding transcript Het
Bltp1 G A 3: 37,041,839 (GRCm39) probably benign Het
Bpifb9a T A 2: 154,103,870 (GRCm39) C104* probably null Het
Cacna2d2 T C 9: 107,402,422 (GRCm39) L826P probably damaging Het
Car5b G A X: 162,762,297 (GRCm39) R282C probably damaging Het
Ccdc88c T C 12: 100,913,447 (GRCm39) D526G probably damaging Het
Cdh23 T A 10: 60,167,070 (GRCm39) T1861S probably benign Het
Ces2f A C 8: 105,676,668 (GRCm39) M121L possibly damaging Het
Cfap58 G A 19: 47,929,536 (GRCm39) probably benign Het
Chpf2 T C 5: 24,795,322 (GRCm39) S282P possibly damaging Het
Cluap1 C T 16: 3,751,636 (GRCm39) R332W probably damaging Het
Cma2 A T 14: 56,210,570 (GRCm39) M86L probably benign Het
Cog6 A T 3: 52,903,496 (GRCm39) M134K probably damaging Het
Col1a1 A G 11: 94,842,420 (GRCm39) D1446G unknown Het
Cpne8 T A 15: 90,381,278 (GRCm39) D512V probably damaging Het
Ctnna2 T A 6: 77,582,165 (GRCm39) N352I probably damaging Het
Cyp2c69 A C 19: 39,875,105 (GRCm39) L16R probably damaging Het
Dysf T C 6: 84,076,443 (GRCm39) S603P probably damaging Het
Epha5 A G 5: 84,215,217 (GRCm39) probably null Het
F10 T A 8: 13,098,249 (GRCm39) C151S probably damaging Het
Gpr180 T G 14: 118,397,458 (GRCm39) H317Q possibly damaging Het
Gstp2 T C 19: 4,091,633 (GRCm39) E32G possibly damaging Het
Ikzf5 T C 7: 130,994,229 (GRCm39) T133A possibly damaging Het
Itch G T 2: 155,024,218 (GRCm39) G274* probably null Het
Jarid2 T A 13: 45,056,307 (GRCm39) N365K probably benign Het
Lama3 T A 18: 12,694,758 (GRCm39) S1295T possibly damaging Het
Lipc A G 9: 70,719,987 (GRCm39) L255P probably damaging Het
Lrrc38 A G 4: 143,077,328 (GRCm39) D197G probably benign Het
Mfap2 A G 4: 140,741,496 (GRCm39) probably benign Het
Mfhas1 A G 8: 36,056,202 (GRCm39) K226E probably damaging Het
Morc1 A G 16: 48,386,020 (GRCm39) R548G probably benign Het
Mrgprb5 T C 7: 47,818,633 (GRCm39) N34S probably benign Het
Mroh4 T C 15: 74,497,276 (GRCm39) T182A probably benign Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Myo5a T C 9: 75,074,319 (GRCm39) F743L possibly damaging Het
Notch4 A C 17: 34,802,407 (GRCm39) D1276A probably damaging Het
Or1e34 A T 11: 73,778,843 (GRCm39) Y118* probably null Het
Or3a10 A G 11: 73,935,873 (GRCm39) C76R possibly damaging Het
Or6c209 T A 10: 129,483,218 (GRCm39) C74S probably damaging Het
Or6d15 T A 6: 116,559,617 (GRCm39) I97L probably benign Het
Plin4 T A 17: 56,413,567 (GRCm39) T353S probably damaging Het
Ppp1r9a A G 6: 5,115,357 (GRCm39) T827A probably benign Het
Prlr C T 15: 10,317,652 (GRCm39) T40I probably damaging Het
Psme3 T C 11: 101,210,730 (GRCm39) probably benign Het
Pygb A T 2: 150,657,626 (GRCm39) D363V probably benign Het
Rsph6a C T 7: 18,788,871 (GRCm39) Q68* probably null Het
Serpini2 A G 3: 75,165,445 (GRCm39) V178A probably benign Het
Sh2d2a T C 3: 87,759,195 (GRCm39) probably benign Het
Skint7 A C 4: 111,837,395 (GRCm39) M58L probably benign Het
Slco3a1 G T 7: 73,970,301 (GRCm39) Y435* probably null Het
Stk17b T C 1: 53,801,742 (GRCm39) probably benign Het
Tinag T A 9: 76,938,992 (GRCm39) H162L possibly damaging Het
Ttc21a T A 9: 119,787,865 (GRCm39) L811Q probably damaging Het
Ttc41 A T 10: 86,594,961 (GRCm39) M912L probably benign Het
Vmn2r98 G T 17: 19,273,875 (GRCm39) V41F probably benign Het
Washc5 C T 15: 59,213,942 (GRCm39) C838Y possibly damaging Het
Wrnip1 A G 13: 32,990,796 (GRCm39) T352A probably damaging Het
Zan A C 5: 137,394,439 (GRCm39) C4467G unknown Het
Zc3h7a T C 16: 10,970,197 (GRCm39) probably benign Het
Zfp729a C A 13: 67,768,345 (GRCm39) C628F probably benign Het
Other mutations in Ercc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Ercc3 APN 18 32,397,598 (GRCm39) splice site probably benign
IGL01108:Ercc3 APN 18 32,397,638 (GRCm39) missense probably damaging 0.99
IGL01131:Ercc3 APN 18 32,402,942 (GRCm39) makesense probably null
IGL01541:Ercc3 APN 18 32,381,372 (GRCm39) missense possibly damaging 0.87
IGL01959:Ercc3 APN 18 32,390,411 (GRCm39) missense probably damaging 1.00
IGL02862:Ercc3 APN 18 32,376,255 (GRCm39) critical splice donor site probably null
IGL03107:Ercc3 APN 18 32,381,360 (GRCm39) missense possibly damaging 0.95
IGL03334:Ercc3 APN 18 32,373,890 (GRCm39) critical splice donor site probably null
PIT4651001:Ercc3 UTSW 18 32,373,365 (GRCm39) unclassified probably benign
R0561:Ercc3 UTSW 18 32,378,592 (GRCm39) missense possibly damaging 0.85
R1159:Ercc3 UTSW 18 32,397,611 (GRCm39) missense possibly damaging 0.86
R1496:Ercc3 UTSW 18 32,394,350 (GRCm39) splice site probably benign
R1733:Ercc3 UTSW 18 32,400,218 (GRCm39) missense possibly damaging 0.60
R1943:Ercc3 UTSW 18 32,379,663 (GRCm39) missense probably damaging 1.00
R2013:Ercc3 UTSW 18 32,381,482 (GRCm39) missense probably benign
R2015:Ercc3 UTSW 18 32,381,482 (GRCm39) missense probably benign
R2303:Ercc3 UTSW 18 32,378,600 (GRCm39) missense probably benign 0.08
R4393:Ercc3 UTSW 18 32,398,674 (GRCm39) missense probably benign 0.00
R4600:Ercc3 UTSW 18 32,378,624 (GRCm39) missense probably benign 0.00
R4601:Ercc3 UTSW 18 32,378,624 (GRCm39) missense probably benign 0.00
R4602:Ercc3 UTSW 18 32,378,624 (GRCm39) missense probably benign 0.00
R4603:Ercc3 UTSW 18 32,378,624 (GRCm39) missense probably benign 0.00
R4796:Ercc3 UTSW 18 32,381,363 (GRCm39) missense probably damaging 1.00
R4957:Ercc3 UTSW 18 32,376,170 (GRCm39) missense probably damaging 1.00
R5253:Ercc3 UTSW 18 32,402,917 (GRCm39) missense probably damaging 0.97
R5265:Ercc3 UTSW 18 32,387,296 (GRCm39) missense probably damaging 0.99
R5342:Ercc3 UTSW 18 32,378,648 (GRCm39) missense probably benign 0.01
R5455:Ercc3 UTSW 18 32,400,262 (GRCm39) missense possibly damaging 0.89
R5639:Ercc3 UTSW 18 32,398,767 (GRCm39) missense probably damaging 0.99
R5702:Ercc3 UTSW 18 32,387,206 (GRCm39) missense probably damaging 0.99
R6026:Ercc3 UTSW 18 32,378,974 (GRCm39) critical splice donor site probably null
R6053:Ercc3 UTSW 18 32,379,807 (GRCm39) missense probably damaging 1.00
R6650:Ercc3 UTSW 18 32,394,389 (GRCm39) missense probably damaging 1.00
R7150:Ercc3 UTSW 18 32,390,325 (GRCm39) missense probably damaging 1.00
R7783:Ercc3 UTSW 18 32,381,296 (GRCm39) missense probably damaging 1.00
R8331:Ercc3 UTSW 18 32,373,871 (GRCm39) missense probably damaging 0.97
R8905:Ercc3 UTSW 18 32,398,771 (GRCm39) missense possibly damaging 0.94
Z1177:Ercc3 UTSW 18 32,387,214 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGATTTCTAAGACGGCGGC -3'
(R):5'- GGTTTGCACAGAAAGGCAGCAC -3'

Sequencing Primer
(F):5'- TAAGACGGCGGCGGAAG -3'
(R):5'- ccctcctcccctcccac -3'
Posted On 2013-06-11