Incidental Mutation 'R5785:Cers4'
ID447961
Institutional Source Beutler Lab
Gene Symbol Cers4
Ensembl Gene ENSMUSG00000008206
Gene Nameceramide synthase 4
SynonymsLass4, CerS4, Trh1, 2900019C14Rik
MMRRC Submission 043206-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5785 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location4493026-4531680 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 4516992 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000008350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008350] [ENSMUST00000176042] [ENSMUST00000176130]
Predicted Effect probably null
Transcript: ENSMUST00000008350
SMART Domains Protein: ENSMUSP00000008350
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
HOX 75 132 2.42e-2 SMART
TLC 131 332 2.74e-82 SMART
low complexity region 342 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175781
SMART Domains Protein: ENSMUSP00000138819
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
HOX 75 132 2.42e-2 SMART
TLC 131 332 2.74e-82 SMART
low complexity region 342 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176042
SMART Domains Protein: ENSMUSP00000135594
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
Blast:TLC 4 38 4e-9 BLAST
low complexity region 39 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176130
SMART Domains Protein: ENSMUSP00000135652
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
transmembrane domain 39 56 N/A INTRINSIC
HOX 75 132 1.2e-4 SMART
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177010
SMART Domains Protein: ENSMUSP00000135763
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
Blast:TLC 4 58 7e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193830
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered lipid composition of the sebum and hair follicle dystrophy that results in a progressive form of alopecia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A T 9: 99,620,672 N295I probably damaging Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Apbb1 C A 7: 105,567,715 D254Y probably damaging Het
Arhgap39 T C 15: 76,737,418 M328V probably benign Het
Bub1b T A 2: 118,609,844 V143D probably damaging Het
Celsr3 A G 9: 108,827,797 D493G probably damaging Het
Clec4d A G 6: 123,274,770 R204G probably benign Het
Cngb1 C A 8: 95,254,195 R910L possibly damaging Het
Coro2a A T 4: 46,564,691 N18K probably benign Het
Cwf19l1 A G 19: 44,121,941 F290S probably damaging Het
Esp18 C T 17: 39,409,948 T28I probably damaging Het
Hdac10 A T 15: 89,126,945 F205Y probably benign Het
Hhip T A 8: 79,998,192 H317L possibly damaging Het
Il1f8 G A 2: 24,154,649 M20I probably benign Het
Ilf3 T A 9: 21,394,872 N276K probably damaging Het
Jchain T C 5: 88,522,517 N81S probably benign Het
Mei4 A G 9: 82,025,547 Y211C probably damaging Het
Mx2 A T 16: 97,538,704 E20V possibly damaging Het
Ndufa10 A G 1: 92,460,374 probably null Het
Nodal A G 10: 61,423,677 T298A probably damaging Het
Nvl T C 1: 181,139,298 Y47C probably damaging Het
Olfr1500 T C 19: 13,827,619 Y259C probably damaging Het
Onecut1 C T 9: 74,863,392 R366C probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp5c A G 7: 17,027,691 probably null Het
Prag1 A G 8: 36,103,487 E408G probably benign Het
Ptpn21 T C 12: 98,682,550 N949S probably damaging Het
Scn7a A C 2: 66,697,568 N859K possibly damaging Het
Smarca4 T C 9: 21,686,026 I1362T probably damaging Het
Syt12 T C 19: 4,450,994 R343G possibly damaging Het
Topbp1 T C 9: 103,323,528 S587P probably benign Het
Trim80 C T 11: 115,446,475 Q388* probably null Het
Tsc2 T C 17: 24,599,887 probably null Het
Vmn2r3 T A 3: 64,259,023 T896S possibly damaging Het
Vmn2r-ps130 T A 17: 23,061,487 S41T probably benign Het
Xirp2 A G 2: 67,509,662 E749G probably damaging Het
Zbtb24 G A 10: 41,451,853 G245E probably benign Het
Zfp507 A G 7: 35,787,742 V767A probably benign Het
Other mutations in Cers4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Cers4 APN 8 4521216 missense probably benign 0.13
IGL02407:Cers4 APN 8 4520306 nonsense probably null
IGL03244:Cers4 APN 8 4516878 missense probably damaging 0.99
Radlauer UTSW 8 4519475 missense probably damaging 1.00
willis UTSW 8 4518269 nonsense probably null
R1170:Cers4 UTSW 8 4519475 missense probably damaging 1.00
R1177:Cers4 UTSW 8 4516931 missense probably null 0.00
R1346:Cers4 UTSW 8 4515632 missense probably damaging 1.00
R1506:Cers4 UTSW 8 4520557 missense probably benign 0.30
R1652:Cers4 UTSW 8 4516908 unclassified probably null
R1819:Cers4 UTSW 8 4521232 missense probably benign 0.00
R1952:Cers4 UTSW 8 4523461 nonsense probably null
R3790:Cers4 UTSW 8 4518285 missense possibly damaging 0.87
R4342:Cers4 UTSW 8 4521223 missense probably damaging 1.00
R5001:Cers4 UTSW 8 4515565 missense probably benign 0.33
R5338:Cers4 UTSW 8 4515680 missense probably damaging 0.98
R5980:Cers4 UTSW 8 4518269 nonsense probably null
R6315:Cers4 UTSW 8 4516980 missense probably benign 0.02
R6891:Cers4 UTSW 8 4523731 missense probably damaging 0.99
R7554:Cers4 UTSW 8 4515718 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATACTGGTAAGGCTTCCCCAAG -3'
(R):5'- GATCCACTAGTCTCTGCACAGC -3'

Sequencing Primer
(F):5'- AAGCCTCAGGTCCTCTCAC -3'
(R):5'- TGGGGGTCTCACAAACCAG -3'
Posted On2016-12-15