Incidental Mutation 'R5785:Hhip'
ID447963
Institutional Source Beutler Lab
Gene Symbol Hhip
Ensembl Gene ENSMUSG00000064325
Gene NameHedgehog-interacting protein
SynonymsHip, Hhip1, Hip1
MMRRC Submission 043206-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5785 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location79965851-80058006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79998192 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 317 (H317L)
Ref Sequence ENSEMBL: ENSMUSP00000078047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079038]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079038
AA Change: H317L

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078047
Gene: ENSMUSG00000064325
AA Change: H317L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Folate_rec 38 220 4.9e-26 PFAM
Pfam:GSDH 226 444 3e-22 PFAM
EGF 593 635 9.63e0 SMART
EGF 638 667 2.35e-2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hedgehog-interacting protein (HHIP) family. The hedgehog (HH) proteins are evolutionarily conserved protein, which are important morphogens for a wide range of developmental processes, including anteroposterior patterns of limbs and regulation of left-right asymmetry in embryonic development. Multiple cell-surface receptors are responsible for transducing and/or regulating HH signals. The HHIP encoded by this gene is a highly conserved, vertebrate-specific inhibitor of HH signaling. It interacts with all three HH family members, SHH, IHH and DHH. Two single nucleotide polymorphisms (SNPs) near this gene are significantly associated with risk of chronic obstructive pulmonary disease (COPD). A single nucleotide polymorphism in this gene is also strongly associated with human height.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a reporter allele die shortly after birth due to respiratory failure, show defects in lung, spleen and pancreas morphogenesis, and exhibit small and disorganized pancreatic islets and reduced beta-cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A T 9: 99,620,672 N295I probably damaging Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Apbb1 C A 7: 105,567,715 D254Y probably damaging Het
Arhgap39 T C 15: 76,737,418 M328V probably benign Het
Bub1b T A 2: 118,609,844 V143D probably damaging Het
Celsr3 A G 9: 108,827,797 D493G probably damaging Het
Cers4 T A 8: 4,516,992 probably null Het
Clec4d A G 6: 123,274,770 R204G probably benign Het
Cngb1 C A 8: 95,254,195 R910L possibly damaging Het
Coro2a A T 4: 46,564,691 N18K probably benign Het
Cwf19l1 A G 19: 44,121,941 F290S probably damaging Het
Esp18 C T 17: 39,409,948 T28I probably damaging Het
Hdac10 A T 15: 89,126,945 F205Y probably benign Het
Il1f8 G A 2: 24,154,649 M20I probably benign Het
Ilf3 T A 9: 21,394,872 N276K probably damaging Het
Jchain T C 5: 88,522,517 N81S probably benign Het
Mei4 A G 9: 82,025,547 Y211C probably damaging Het
Mx2 A T 16: 97,538,704 E20V possibly damaging Het
Ndufa10 A G 1: 92,460,374 probably null Het
Nodal A G 10: 61,423,677 T298A probably damaging Het
Nvl T C 1: 181,139,298 Y47C probably damaging Het
Olfr1500 T C 19: 13,827,619 Y259C probably damaging Het
Onecut1 C T 9: 74,863,392 R366C probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp5c A G 7: 17,027,691 probably null Het
Prag1 A G 8: 36,103,487 E408G probably benign Het
Ptpn21 T C 12: 98,682,550 N949S probably damaging Het
Scn7a A C 2: 66,697,568 N859K possibly damaging Het
Smarca4 T C 9: 21,686,026 I1362T probably damaging Het
Syt12 T C 19: 4,450,994 R343G possibly damaging Het
Topbp1 T C 9: 103,323,528 S587P probably benign Het
Trim80 C T 11: 115,446,475 Q388* probably null Het
Tsc2 T C 17: 24,599,887 probably null Het
Vmn2r3 T A 3: 64,259,023 T896S possibly damaging Het
Vmn2r-ps130 T A 17: 23,061,487 S41T probably benign Het
Xirp2 A G 2: 67,509,662 E749G probably damaging Het
Zbtb24 G A 10: 41,451,853 G245E probably benign Het
Zfp507 A G 7: 35,787,742 V767A probably benign Het
Other mutations in Hhip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Hhip APN 8 79996783 missense probably damaging 0.96
IGL02560:Hhip APN 8 79987009 missense probably damaging 0.98
IGL03046:Hhip UTSW 8 79972338 missense probably damaging 0.99
R0068:Hhip UTSW 8 79989256 missense probably damaging 1.00
R0356:Hhip UTSW 8 79997492 missense probably benign 0.20
R0707:Hhip UTSW 8 79998255 missense probably damaging 1.00
R1163:Hhip UTSW 8 79992476 missense probably damaging 1.00
R1583:Hhip UTSW 8 79990276 missense probably damaging 1.00
R1900:Hhip UTSW 8 79975046 missense probably benign 0.15
R2071:Hhip UTSW 8 80057302 missense probably benign 0.00
R2255:Hhip UTSW 8 80045181 missense probably damaging 0.98
R3847:Hhip UTSW 8 79997495 missense probably benign 0.00
R4012:Hhip UTSW 8 79992594 missense probably damaging 1.00
R4448:Hhip UTSW 8 80043945 critical splice donor site probably null
R4607:Hhip UTSW 8 79997563 missense probably damaging 0.99
R4608:Hhip UTSW 8 79997563 missense probably damaging 0.99
R4677:Hhip UTSW 8 80045097 missense probably damaging 0.96
R4738:Hhip UTSW 8 79992570 missense probably damaging 0.98
R5040:Hhip UTSW 8 79997606 missense probably benign 0.00
R5371:Hhip UTSW 8 79997591 missense probably damaging 0.98
R5594:Hhip UTSW 8 79996863 missense probably damaging 1.00
R6026:Hhip UTSW 8 79972440 missense probably damaging 1.00
R6259:Hhip UTSW 8 79972404 missense probably damaging 1.00
R6782:Hhip UTSW 8 80051604 missense probably damaging 1.00
R7105:Hhip UTSW 8 79975009 missense probably benign 0.04
R7134:Hhip UTSW 8 79992513 missense probably benign
R7238:Hhip UTSW 8 79987012 missense probably benign
R7828:Hhip UTSW 8 79998208 missense probably benign 0.00
X0026:Hhip UTSW 8 79992560 missense possibly damaging 0.93
Z1177:Hhip UTSW 8 80057251 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCACACACTATGTTTTAAGTCATGGG -3'
(R):5'- GTTGGGCAAAGATTACCCGG -3'

Sequencing Primer
(F):5'- AAGTCATGGGATTATTCTGCTCTAG -3'
(R):5'- CGGAAGAACCTCTTTTCCAGG -3'
Posted On2016-12-15