Incidental Mutation 'R5785:A4gnt'
ID447969
Institutional Source Beutler Lab
Gene Symbol A4gnt
Ensembl Gene ENSMUSG00000037953
Gene Namealpha-1,4-N-acetylglucosaminyltransferase
Synonymsalpha4GnT, LOC333424
MMRRC Submission 043206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5785 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location99612502-99622367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99620672 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 295 (N295I)
Ref Sequence ENSEMBL: ENSMUSP00000045629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042553]
Predicted Effect probably damaging
Transcript: ENSMUST00000042553
AA Change: N295I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045629
Gene: ENSMUSG00000037953
AA Change: N295I

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:Gly_transf_sug 65 188 4e-26 PFAM
Pfam:Gb3_synth 197 324 2.5e-49 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein from the glycosyltransferase 32 family. The encoded enzyme catalyzes the transfer of N-acetylglucosamine to alpha-1,4-linked beta-galactose residues. This enzyme is required for type III mucin synthesis and it is largely associated with the Golgi apparatus membrane. The encoded protein appears to be expressed in adenocarcinoma cells of pancreatic, biliary tract and gastric cancers.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit gastric adenocarcinoma with increased cell proliferation, angiogenesis, inflammation and gastric mucosal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Apbb1 C A 7: 105,567,715 D254Y probably damaging Het
Arhgap39 T C 15: 76,737,418 M328V probably benign Het
Bub1b T A 2: 118,609,844 V143D probably damaging Het
Celsr3 A G 9: 108,827,797 D493G probably damaging Het
Cers4 T A 8: 4,516,992 probably null Het
Clec4d A G 6: 123,274,770 R204G probably benign Het
Cngb1 C A 8: 95,254,195 R910L possibly damaging Het
Coro2a A T 4: 46,564,691 N18K probably benign Het
Cwf19l1 A G 19: 44,121,941 F290S probably damaging Het
Esp18 C T 17: 39,409,948 T28I probably damaging Het
Hdac10 A T 15: 89,126,945 F205Y probably benign Het
Hhip T A 8: 79,998,192 H317L possibly damaging Het
Il1f8 G A 2: 24,154,649 M20I probably benign Het
Ilf3 T A 9: 21,394,872 N276K probably damaging Het
Jchain T C 5: 88,522,517 N81S probably benign Het
Mei4 A G 9: 82,025,547 Y211C probably damaging Het
Mx2 A T 16: 97,538,704 E20V possibly damaging Het
Ndufa10 A G 1: 92,460,374 probably null Het
Nodal A G 10: 61,423,677 T298A probably damaging Het
Nvl T C 1: 181,139,298 Y47C probably damaging Het
Olfr1500 T C 19: 13,827,619 Y259C probably damaging Het
Onecut1 C T 9: 74,863,392 R366C probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp5c A G 7: 17,027,691 probably null Het
Prag1 A G 8: 36,103,487 E408G probably benign Het
Ptpn21 T C 12: 98,682,550 N949S probably damaging Het
Scn7a A C 2: 66,697,568 N859K possibly damaging Het
Smarca4 T C 9: 21,686,026 I1362T probably damaging Het
Syt12 T C 19: 4,450,994 R343G possibly damaging Het
Topbp1 T C 9: 103,323,528 S587P probably benign Het
Trim80 C T 11: 115,446,475 Q388* probably null Het
Tsc2 T C 17: 24,599,887 probably null Het
Vmn2r3 T A 3: 64,259,023 T896S possibly damaging Het
Vmn2r-ps130 T A 17: 23,061,487 S41T probably benign Het
Xirp2 A G 2: 67,509,662 E749G probably damaging Het
Zbtb24 G A 10: 41,451,853 G245E probably benign Het
Zfp507 A G 7: 35,787,742 V767A probably benign Het
Other mutations in A4gnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:A4gnt APN 9 99620436 nonsense probably null
IGL01509:A4gnt APN 9 99613766 missense probably benign 0.01
IGL02335:A4gnt APN 9 99620213 missense probably benign
IGL03339:A4gnt APN 9 99620548 missense probably damaging 1.00
PIT4466001:A4gnt UTSW 9 99620560 missense probably damaging 0.99
PIT4472001:A4gnt UTSW 9 99620560 missense probably damaging 0.99
R2027:A4gnt UTSW 9 99620201 missense possibly damaging 0.50
R2061:A4gnt UTSW 9 99620359 missense probably damaging 1.00
R4130:A4gnt UTSW 9 99620618 missense possibly damaging 0.81
R4131:A4gnt UTSW 9 99620618 missense possibly damaging 0.81
R5249:A4gnt UTSW 9 99620231 missense probably damaging 0.99
R5338:A4gnt UTSW 9 99620544 missense probably damaging 1.00
R5672:A4gnt UTSW 9 99620330 missense possibly damaging 0.95
R6519:A4gnt UTSW 9 99613670 missense probably damaging 1.00
R6630:A4gnt UTSW 9 99613918 missense probably benign 0.00
R7296:A4gnt UTSW 9 99620282 missense probably damaging 0.97
R7514:A4gnt UTSW 9 99620545 missense probably benign 0.05
R7731:A4gnt UTSW 9 99620417 missense possibly damaging 0.63
Z1088:A4gnt UTSW 9 99613841 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAAGACTTCCACGGGTTGGG -3'
(R):5'- GGATTAGCACCTATCCCCTAGAG -3'

Sequencing Primer
(F):5'- GGTGACCTGAAGTGTTTGAATATTTC -3'
(R):5'- GTAGCCCAGGAAGCATCTACTCTTC -3'
Posted On2016-12-15