Incidental Mutation 'R5785:Hdac10'
ID447980
Institutional Source Beutler Lab
Gene Symbol Hdac10
Ensembl Gene ENSMUSG00000062906
Gene Namehistone deacetylase 10
Synonyms
MMRRC Submission 043206-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5785 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89123307-89128700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89126945 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 205 (F205Y)
Ref Sequence ENSEMBL: ENSMUSP00000104971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082197] [ENSMUST00000088827] [ENSMUST00000109347] [ENSMUST00000109353]
Predicted Effect probably benign
Transcript: ENSMUST00000041656
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082197
AA Change: F205Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080832
Gene: ENSMUSG00000062906
AA Change: F205Y

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 322 2.1e-85 PFAM
low complexity region 478 489 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088827
SMART Domains Protein: ENSMUSP00000086207
Gene: ENSMUSG00000022610

DomainStartEndE-ValueType
S_TKc 27 311 1.63e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109347
AA Change: F205Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104971
Gene: ENSMUSG00000062906
AA Change: F205Y

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 251 6.1e-66 PFAM
low complexity region 270 282 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109353
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231098
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the histone deacetylase family, members of which deacetylate lysine residues on the N-terminal part of the core histones. Histone deacetylation modulates chromatin structure, and plays an important role in transcriptional regulation, cell cycle progression, and developmental events. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A T 9: 99,620,672 N295I probably damaging Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Apbb1 C A 7: 105,567,715 D254Y probably damaging Het
Arhgap39 T C 15: 76,737,418 M328V probably benign Het
Bub1b T A 2: 118,609,844 V143D probably damaging Het
Celsr3 A G 9: 108,827,797 D493G probably damaging Het
Cers4 T A 8: 4,516,992 probably null Het
Clec4d A G 6: 123,274,770 R204G probably benign Het
Cngb1 C A 8: 95,254,195 R910L possibly damaging Het
Coro2a A T 4: 46,564,691 N18K probably benign Het
Cwf19l1 A G 19: 44,121,941 F290S probably damaging Het
Esp18 C T 17: 39,409,948 T28I probably damaging Het
Hhip T A 8: 79,998,192 H317L possibly damaging Het
Il1f8 G A 2: 24,154,649 M20I probably benign Het
Ilf3 T A 9: 21,394,872 N276K probably damaging Het
Jchain T C 5: 88,522,517 N81S probably benign Het
Mei4 A G 9: 82,025,547 Y211C probably damaging Het
Mx2 A T 16: 97,538,704 E20V possibly damaging Het
Ndufa10 A G 1: 92,460,374 probably null Het
Nodal A G 10: 61,423,677 T298A probably damaging Het
Nvl T C 1: 181,139,298 Y47C probably damaging Het
Olfr1500 T C 19: 13,827,619 Y259C probably damaging Het
Onecut1 C T 9: 74,863,392 R366C probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp5c A G 7: 17,027,691 probably null Het
Prag1 A G 8: 36,103,487 E408G probably benign Het
Ptpn21 T C 12: 98,682,550 N949S probably damaging Het
Scn7a A C 2: 66,697,568 N859K possibly damaging Het
Smarca4 T C 9: 21,686,026 I1362T probably damaging Het
Syt12 T C 19: 4,450,994 R343G possibly damaging Het
Topbp1 T C 9: 103,323,528 S587P probably benign Het
Trim80 C T 11: 115,446,475 Q388* probably null Het
Tsc2 T C 17: 24,599,887 probably null Het
Vmn2r3 T A 3: 64,259,023 T896S possibly damaging Het
Vmn2r-ps130 T A 17: 23,061,487 S41T probably benign Het
Xirp2 A G 2: 67,509,662 E749G probably damaging Het
Zbtb24 G A 10: 41,451,853 G245E probably benign Het
Zfp507 A G 7: 35,787,742 V767A probably benign Het
Other mutations in Hdac10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Hdac10 APN 15 89128442 missense probably damaging 1.00
IGL01063:Hdac10 APN 15 89123868 missense possibly damaging 0.68
IGL01577:Hdac10 APN 15 89126213 missense possibly damaging 0.90
IGL01690:Hdac10 APN 15 89125991 missense probably benign 0.00
IGL01724:Hdac10 APN 15 89124709 unclassified probably benign
IGL01866:Hdac10 APN 15 89124533 missense probably damaging 1.00
IGL01989:Hdac10 APN 15 89125343 missense probably damaging 1.00
IGL01995:Hdac10 APN 15 89127598 missense probably damaging 1.00
IGL02256:Hdac10 APN 15 89125894 unclassified probably benign
IGL02668:Hdac10 APN 15 89125644 missense probably benign 0.10
R0240:Hdac10 UTSW 15 89125882 missense possibly damaging 0.65
R0240:Hdac10 UTSW 15 89125882 missense possibly damaging 0.65
R0454:Hdac10 UTSW 15 89125758 splice site probably null
R0723:Hdac10 UTSW 15 89126418 missense probably damaging 1.00
R0924:Hdac10 UTSW 15 89125862 missense probably benign
R1553:Hdac10 UTSW 15 89125515 missense possibly damaging 0.51
R1608:Hdac10 UTSW 15 89125318 missense probably benign 0.04
R1619:Hdac10 UTSW 15 89126675 missense probably damaging 1.00
R1715:Hdac10 UTSW 15 89126709 splice site probably null
R2284:Hdac10 UTSW 15 89127404 missense probably benign 0.00
R2872:Hdac10 UTSW 15 89125856 missense possibly damaging 0.46
R2872:Hdac10 UTSW 15 89125856 missense possibly damaging 0.46
R3688:Hdac10 UTSW 15 89123564 critical splice donor site probably null
R4283:Hdac10 UTSW 15 89125623 missense possibly damaging 0.94
R4604:Hdac10 UTSW 15 89125397 critical splice acceptor site probably null
R4654:Hdac10 UTSW 15 89126833 unclassified probably benign
R4898:Hdac10 UTSW 15 89128447 start codon destroyed probably null 1.00
R4998:Hdac10 UTSW 15 89123940 missense possibly damaging 0.94
R5393:Hdac10 UTSW 15 89126684 missense probably damaging 1.00
R5769:Hdac10 UTSW 15 89123616 missense probably benign 0.00
R6992:Hdac10 UTSW 15 89125331 missense probably benign 0.01
R7149:Hdac10 UTSW 15 89127449 missense probably damaging 1.00
R7237:Hdac10 UTSW 15 89125377 missense probably benign
R7276:Hdac10 UTSW 15 89128285 missense probably benign 0.01
R7395:Hdac10 UTSW 15 89128284 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTCACCCCTGGGATCCAAAGTC -3'
(R):5'- TTCAACGATGACCCCAGGTG -3'

Sequencing Primer
(F):5'- TCCAAAGTCCAGGGAGACTCTTG -3'
(R):5'- GTGGACACAGCCCTTCTCTG -3'
Posted On2016-12-15