Incidental Mutation 'R5785:Mx2'
ID447981
Institutional Source Beutler Lab
Gene Symbol Mx2
Ensembl Gene ENSMUSG00000023341
Gene NameMX dynamin-like GTPase 2
SynonymsMx-2
MMRRC Submission 043206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R5785 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location97535308-97560900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97538704 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 20 (E20V)
Ref Sequence ENSEMBL: ENSMUSP00000141038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024112] [ENSMUST00000188251] [ENSMUST00000190447]
Predicted Effect probably benign
Transcript: ENSMUST00000024112
AA Change: E20V

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024112
Gene: ENSMUSG00000023341
AA Change: E20V

DomainStartEndE-ValueType
DYNc 39 282 2.71e-135 SMART
Blast:DYNc 426 539 4e-17 BLAST
GED 562 653 9.88e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188251
AA Change: E20V

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141038
Gene: ENSMUSG00000023341
AA Change: E20V

DomainStartEndE-ValueType
DYNc 39 282 1.3e-137 SMART
low complexity region 592 603 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190447
AA Change: E20V

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140229
Gene: ENSMUSG00000023341
AA Change: E20V

DomainStartEndE-ValueType
DYNc 39 282 1.3e-137 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A T 9: 99,620,672 N295I probably damaging Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Apbb1 C A 7: 105,567,715 D254Y probably damaging Het
Arhgap39 T C 15: 76,737,418 M328V probably benign Het
Bub1b T A 2: 118,609,844 V143D probably damaging Het
Celsr3 A G 9: 108,827,797 D493G probably damaging Het
Cers4 T A 8: 4,516,992 probably null Het
Clec4d A G 6: 123,274,770 R204G probably benign Het
Cngb1 C A 8: 95,254,195 R910L possibly damaging Het
Coro2a A T 4: 46,564,691 N18K probably benign Het
Cwf19l1 A G 19: 44,121,941 F290S probably damaging Het
Esp18 C T 17: 39,409,948 T28I probably damaging Het
Hdac10 A T 15: 89,126,945 F205Y probably benign Het
Hhip T A 8: 79,998,192 H317L possibly damaging Het
Il1f8 G A 2: 24,154,649 M20I probably benign Het
Ilf3 T A 9: 21,394,872 N276K probably damaging Het
Jchain T C 5: 88,522,517 N81S probably benign Het
Mei4 A G 9: 82,025,547 Y211C probably damaging Het
Ndufa10 A G 1: 92,460,374 probably null Het
Nodal A G 10: 61,423,677 T298A probably damaging Het
Nvl T C 1: 181,139,298 Y47C probably damaging Het
Olfr1500 T C 19: 13,827,619 Y259C probably damaging Het
Onecut1 C T 9: 74,863,392 R366C probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp5c A G 7: 17,027,691 probably null Het
Prag1 A G 8: 36,103,487 E408G probably benign Het
Ptpn21 T C 12: 98,682,550 N949S probably damaging Het
Scn7a A C 2: 66,697,568 N859K possibly damaging Het
Smarca4 T C 9: 21,686,026 I1362T probably damaging Het
Syt12 T C 19: 4,450,994 R343G possibly damaging Het
Topbp1 T C 9: 103,323,528 S587P probably benign Het
Trim80 C T 11: 115,446,475 Q388* probably null Het
Tsc2 T C 17: 24,599,887 probably null Het
Vmn2r3 T A 3: 64,259,023 T896S possibly damaging Het
Vmn2r-ps130 T A 17: 23,061,487 S41T probably benign Het
Xirp2 A G 2: 67,509,662 E749G probably damaging Het
Zbtb24 G A 10: 41,451,853 G245E probably benign Het
Zfp507 A G 7: 35,787,742 V767A probably benign Het
Other mutations in Mx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Mx2 APN 16 97544478 missense probably damaging 0.99
IGL01111:Mx2 APN 16 97558719 missense probably benign
IGL02103:Mx2 APN 16 97544595 missense probably damaging 1.00
IGL02678:Mx2 APN 16 97556120 critical splice donor site probably null
IGL03166:Mx2 APN 16 97546790 missense probably damaging 1.00
IGL03323:Mx2 APN 16 97546375 missense probably damaging 0.99
R0254:Mx2 UTSW 16 97556095 missense probably benign
R0699:Mx2 UTSW 16 97544553 missense probably damaging 1.00
R1180:Mx2 UTSW 16 97556009 missense probably damaging 1.00
R1702:Mx2 UTSW 16 97558683 missense probably benign
R1762:Mx2 UTSW 16 97538703 missense probably benign 0.09
R1922:Mx2 UTSW 16 97560351 missense probably benign 0.05
R2049:Mx2 UTSW 16 97538703 missense probably benign 0.09
R2141:Mx2 UTSW 16 97538703 missense probably benign 0.09
R2142:Mx2 UTSW 16 97538703 missense probably benign 0.09
R3010:Mx2 UTSW 16 97546799 missense possibly damaging 0.85
R4079:Mx2 UTSW 16 97556036 missense probably damaging 0.98
R4553:Mx2 UTSW 16 97552005 missense possibly damaging 0.52
R4594:Mx2 UTSW 16 97547432 nonsense probably null
R5211:Mx2 UTSW 16 97547433 missense probably damaging 1.00
R6091:Mx2 UTSW 16 97546435 missense probably damaging 1.00
R7250:Mx2 UTSW 16 97547464 missense probably damaging 0.99
R7485:Mx2 UTSW 16 97545718 missense probably benign 0.11
R7793:Mx2 UTSW 16 97546883 missense probably damaging 1.00
R7816:Mx2 UTSW 16 97545612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATCCCCTCCCACATGAG -3'
(R):5'- GACAACATTGCACTGTCCAGG -3'

Sequencing Primer
(F):5'- CCAGAAGGACCCTGGGATG -3'
(R):5'- TTTCCCAGAGCAAGATAAAATCCTGG -3'
Posted On2016-12-15