Incidental Mutation 'R5785:Vmn2r-ps130'
ID447982
Institutional Source Beutler Lab
Gene Symbol Vmn2r-ps130
Ensembl Gene ENSMUSG00000095658
Gene Namevomeronasal 2, receptor, pseudogene 130
Synonyms
MMRRC Submission 043206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5785 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23061367-23077425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23061487 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 41 (S41T)
Ref Sequence ENSEMBL: ENSMUSP00000135186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175853]
Predicted Effect probably benign
Transcript: ENSMUST00000175853
AA Change: S41T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135186
Gene: ENSMUSG00000095658
AA Change: S41T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 76 469 5.4e-24 PFAM
Pfam:NCD3G 511 563 1.3e-21 PFAM
Pfam:7tm_3 594 831 2.1e-54 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A T 9: 99,620,672 N295I probably damaging Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Apbb1 C A 7: 105,567,715 D254Y probably damaging Het
Arhgap39 T C 15: 76,737,418 M328V probably benign Het
Bub1b T A 2: 118,609,844 V143D probably damaging Het
Celsr3 A G 9: 108,827,797 D493G probably damaging Het
Cers4 T A 8: 4,516,992 probably null Het
Clec4d A G 6: 123,274,770 R204G probably benign Het
Cngb1 C A 8: 95,254,195 R910L possibly damaging Het
Coro2a A T 4: 46,564,691 N18K probably benign Het
Cwf19l1 A G 19: 44,121,941 F290S probably damaging Het
Esp18 C T 17: 39,409,948 T28I probably damaging Het
Hdac10 A T 15: 89,126,945 F205Y probably benign Het
Hhip T A 8: 79,998,192 H317L possibly damaging Het
Il1f8 G A 2: 24,154,649 M20I probably benign Het
Ilf3 T A 9: 21,394,872 N276K probably damaging Het
Jchain T C 5: 88,522,517 N81S probably benign Het
Mei4 A G 9: 82,025,547 Y211C probably damaging Het
Mx2 A T 16: 97,538,704 E20V possibly damaging Het
Ndufa10 A G 1: 92,460,374 probably null Het
Nodal A G 10: 61,423,677 T298A probably damaging Het
Nvl T C 1: 181,139,298 Y47C probably damaging Het
Olfr1500 T C 19: 13,827,619 Y259C probably damaging Het
Onecut1 C T 9: 74,863,392 R366C probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp5c A G 7: 17,027,691 probably null Het
Prag1 A G 8: 36,103,487 E408G probably benign Het
Ptpn21 T C 12: 98,682,550 N949S probably damaging Het
Scn7a A C 2: 66,697,568 N859K possibly damaging Het
Smarca4 T C 9: 21,686,026 I1362T probably damaging Het
Syt12 T C 19: 4,450,994 R343G possibly damaging Het
Topbp1 T C 9: 103,323,528 S587P probably benign Het
Trim80 C T 11: 115,446,475 Q388* probably null Het
Tsc2 T C 17: 24,599,887 probably null Het
Vmn2r3 T A 3: 64,259,023 T896S possibly damaging Het
Xirp2 A G 2: 67,509,662 E749G probably damaging Het
Zbtb24 G A 10: 41,451,853 G245E probably benign Het
Zfp507 A G 7: 35,787,742 V767A probably benign Het
Other mutations in Vmn2r-ps130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Vmn2r-ps130 APN 17 23076877 missense possibly damaging 0.79
IGL02346:Vmn2r-ps130 APN 17 23061527 missense possibly damaging 0.89
IGL02373:Vmn2r-ps130 APN 17 23076892 nonsense probably null
R1511:Vmn2r-ps130 UTSW 17 23063801 missense probably benign 0.17
R2373:Vmn2r-ps130 UTSW 17 23061506 missense possibly damaging 0.93
R5047:Vmn2r-ps130 UTSW 17 23063820 missense probably benign
R5317:Vmn2r-ps130 UTSW 17 23063583 missense probably benign
R5588:Vmn2r-ps130 UTSW 17 23063829 missense probably benign 0.44
R6131:Vmn2r-ps130 UTSW 17 23063655 missense probably benign 0.00
R6273:Vmn2r-ps130 UTSW 17 23076785 missense probably benign 0.12
R6580:Vmn2r-ps130 UTSW 17 23063766 missense probably benign 0.00
R7660:Vmn2r-ps130 UTSW 17 23077032 missense probably damaging 1.00
R7852:Vmn2r-ps130 UTSW 17 23063814 missense probably benign 0.04
R7935:Vmn2r-ps130 UTSW 17 23063814 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGATTTGTGTGGCACTTCAC -3'
(R):5'- CTATAAATGGAAGGCAGGCTTG -3'

Sequencing Primer
(F):5'- GTGGCACTTCACAAACCATTCTG -3'
(R):5'- CTTTCTTGTTTTGCACATTAAGAACG -3'
Posted On2016-12-15