Incidental Mutation 'R5785:Syt12'
ID447986
Institutional Source Beutler Lab
Gene Symbol Syt12
Ensembl Gene ENSMUSG00000049303
Gene Namesynaptotagmin XII
Synonyms
MMRRC Submission 043206-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5785 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4445908-4477447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4450994 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 343 (R343G)
Ref Sequence ENSEMBL: ENSMUSP00000055237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059295]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059295
AA Change: R343G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055237
Gene: ENSMUSG00000049303
AA Change: R343G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 45 55 N/A INTRINSIC
C2 168 272 1.8e-6 SMART
C2 299 405 4.9e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154407
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown that the encoded protein selectively modulates spontaneous synaptic-vesicle exocytosis and may also be involved in regulating calcium independent secretion in nonneuronal cells. Alternative splicing results in multiple transcript variants. The gene has previously been referred to as synaptotagmin XI but has been renamed synaptotagmin XII to be standard with mouse and rat official nomenclature.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-in allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A T 9: 99,620,672 N295I probably damaging Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Apbb1 C A 7: 105,567,715 D254Y probably damaging Het
Arhgap39 T C 15: 76,737,418 M328V probably benign Het
Bub1b T A 2: 118,609,844 V143D probably damaging Het
Celsr3 A G 9: 108,827,797 D493G probably damaging Het
Cers4 T A 8: 4,516,992 probably null Het
Clec4d A G 6: 123,274,770 R204G probably benign Het
Cngb1 C A 8: 95,254,195 R910L possibly damaging Het
Coro2a A T 4: 46,564,691 N18K probably benign Het
Cwf19l1 A G 19: 44,121,941 F290S probably damaging Het
Esp18 C T 17: 39,409,948 T28I probably damaging Het
Hdac10 A T 15: 89,126,945 F205Y probably benign Het
Hhip T A 8: 79,998,192 H317L possibly damaging Het
Il1f8 G A 2: 24,154,649 M20I probably benign Het
Ilf3 T A 9: 21,394,872 N276K probably damaging Het
Jchain T C 5: 88,522,517 N81S probably benign Het
Mei4 A G 9: 82,025,547 Y211C probably damaging Het
Mx2 A T 16: 97,538,704 E20V possibly damaging Het
Ndufa10 A G 1: 92,460,374 probably null Het
Nodal A G 10: 61,423,677 T298A probably damaging Het
Nvl T C 1: 181,139,298 Y47C probably damaging Het
Olfr1500 T C 19: 13,827,619 Y259C probably damaging Het
Onecut1 C T 9: 74,863,392 R366C probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp5c A G 7: 17,027,691 probably null Het
Prag1 A G 8: 36,103,487 E408G probably benign Het
Ptpn21 T C 12: 98,682,550 N949S probably damaging Het
Scn7a A C 2: 66,697,568 N859K possibly damaging Het
Smarca4 T C 9: 21,686,026 I1362T probably damaging Het
Topbp1 T C 9: 103,323,528 S587P probably benign Het
Trim80 C T 11: 115,446,475 Q388* probably null Het
Tsc2 T C 17: 24,599,887 probably null Het
Vmn2r3 T A 3: 64,259,023 T896S possibly damaging Het
Vmn2r-ps130 T A 17: 23,061,487 S41T probably benign Het
Xirp2 A G 2: 67,509,662 E749G probably damaging Het
Zbtb24 G A 10: 41,451,853 G245E probably benign Het
Zfp507 A G 7: 35,787,742 V767A probably benign Het
Other mutations in Syt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Syt12 APN 19 4447845 missense probably damaging 0.99
IGL02045:Syt12 APN 19 4447734 missense probably damaging 1.00
IGL02942:Syt12 APN 19 4447830 missense probably benign 0.16
IGL03131:Syt12 APN 19 4456854 missense probably benign
R1308:Syt12 UTSW 19 4460735 missense probably damaging 0.99
R1830:Syt12 UTSW 19 4456883 missense probably benign
R1858:Syt12 UTSW 19 4447797 missense probably damaging 1.00
R4192:Syt12 UTSW 19 4447681 utr 3 prime probably benign
R5646:Syt12 UTSW 19 4456541 missense possibly damaging 0.54
R5769:Syt12 UTSW 19 4451044 missense probably damaging 1.00
R6079:Syt12 UTSW 19 4456868 missense probably benign
R7017:Syt12 UTSW 19 4460867 intron probably null
R7043:Syt12 UTSW 19 4451021 missense probably benign 0.04
R7137:Syt12 UTSW 19 4453950 missense probably damaging 1.00
R8042:Syt12 UTSW 19 4453824 missense probably damaging 0.98
U15987:Syt12 UTSW 19 4456868 missense probably benign
Z1177:Syt12 UTSW 19 4453928 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCTAGTCTCTGGCTCAGTC -3'
(R):5'- CCTGAGTCAAGAGATGCTGG -3'

Sequencing Primer
(F):5'- GTCTCTGGCTCAGTCAATGATTAAC -3'
(R):5'- CCTGAGTCAAGAGATGCTGGTACTC -3'
Posted On2016-12-15