Incidental Mutation 'R5785:Olfr1500'
ID447987
Institutional Source Beutler Lab
Gene Symbol Olfr1500
Ensembl Gene ENSMUSG00000054526
Gene Nameolfactory receptor 1500
SynonymsMOR212-4P, GA_x6K02T2RE5P-4160554-4159619
MMRRC Submission 043206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5785 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13826882-13830488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13827619 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 259 (Y259C)
Ref Sequence ENSEMBL: ENSMUSP00000151471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067670] [ENSMUST00000214475] [ENSMUST00000215760] [ENSMUST00000216287] [ENSMUST00000217079] [ENSMUST00000219674]
Predicted Effect probably damaging
Transcript: ENSMUST00000067670
AA Change: Y259C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067303
Gene: ENSMUSG00000054526
AA Change: Y259C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.8e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 220 9.5e-9 PFAM
Pfam:7tm_1 41 290 4.1e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214475
AA Change: Y259C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214579
Predicted Effect probably damaging
Transcript: ENSMUST00000215760
AA Change: Y259C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216287
AA Change: Y259C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217079
AA Change: Y259C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219674
AA Change: Y259C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A T 9: 99,620,672 N295I probably damaging Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Apbb1 C A 7: 105,567,715 D254Y probably damaging Het
Arhgap39 T C 15: 76,737,418 M328V probably benign Het
Bub1b T A 2: 118,609,844 V143D probably damaging Het
Celsr3 A G 9: 108,827,797 D493G probably damaging Het
Cers4 T A 8: 4,516,992 probably null Het
Clec4d A G 6: 123,274,770 R204G probably benign Het
Cngb1 C A 8: 95,254,195 R910L possibly damaging Het
Coro2a A T 4: 46,564,691 N18K probably benign Het
Cwf19l1 A G 19: 44,121,941 F290S probably damaging Het
Esp18 C T 17: 39,409,948 T28I probably damaging Het
Hdac10 A T 15: 89,126,945 F205Y probably benign Het
Hhip T A 8: 79,998,192 H317L possibly damaging Het
Il1f8 G A 2: 24,154,649 M20I probably benign Het
Ilf3 T A 9: 21,394,872 N276K probably damaging Het
Jchain T C 5: 88,522,517 N81S probably benign Het
Mei4 A G 9: 82,025,547 Y211C probably damaging Het
Mx2 A T 16: 97,538,704 E20V possibly damaging Het
Ndufa10 A G 1: 92,460,374 probably null Het
Nodal A G 10: 61,423,677 T298A probably damaging Het
Nvl T C 1: 181,139,298 Y47C probably damaging Het
Onecut1 C T 9: 74,863,392 R366C probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp5c A G 7: 17,027,691 probably null Het
Prag1 A G 8: 36,103,487 E408G probably benign Het
Ptpn21 T C 12: 98,682,550 N949S probably damaging Het
Scn7a A C 2: 66,697,568 N859K possibly damaging Het
Smarca4 T C 9: 21,686,026 I1362T probably damaging Het
Syt12 T C 19: 4,450,994 R343G possibly damaging Het
Topbp1 T C 9: 103,323,528 S587P probably benign Het
Trim80 C T 11: 115,446,475 Q388* probably null Het
Tsc2 T C 17: 24,599,887 probably null Het
Vmn2r3 T A 3: 64,259,023 T896S possibly damaging Het
Vmn2r-ps130 T A 17: 23,061,487 S41T probably benign Het
Xirp2 A G 2: 67,509,662 E749G probably damaging Het
Zbtb24 G A 10: 41,451,853 G245E probably benign Het
Zfp507 A G 7: 35,787,742 V767A probably benign Het
Other mutations in Olfr1500
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02004:Olfr1500 APN 19 13828063 missense possibly damaging 0.93
IGL03122:Olfr1500 APN 19 13827650 missense possibly damaging 0.91
R0003:Olfr1500 UTSW 19 13827686 missense probably damaging 1.00
R0003:Olfr1500 UTSW 19 13827686 missense probably damaging 1.00
R0118:Olfr1500 UTSW 19 13827565 missense possibly damaging 0.74
R0458:Olfr1500 UTSW 19 13828229 missense probably benign 0.01
R0507:Olfr1500 UTSW 19 13827776 missense possibly damaging 0.49
R0515:Olfr1500 UTSW 19 13827821 missense probably damaging 0.99
R0907:Olfr1500 UTSW 19 13827856 missense probably damaging 1.00
R1524:Olfr1500 UTSW 19 13828315 missense probably damaging 1.00
R2883:Olfr1500 UTSW 19 13827875 missense probably damaging 1.00
R4278:Olfr1500 UTSW 19 13828429 start gained probably benign
R4824:Olfr1500 UTSW 19 13828354 missense probably damaging 1.00
R4981:Olfr1500 UTSW 19 13828094 missense probably damaging 1.00
R6597:Olfr1500 UTSW 19 13828457 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTCTTGAGATTCGCAAGGAGG -3'
(R):5'- CTGTGGTGAGAGCTATATCCAG -3'

Sequencing Primer
(F):5'- GGAAGAGGTTAGAAAGTCTTCACTC -3'
(R):5'- TGGTGAGAGCTATATCCAGGAATTG -3'
Posted On2016-12-15