Incidental Mutation 'R5785:Cwf19l1'
ID447988
Institutional Source Beutler Lab
Gene Symbol Cwf19l1
Ensembl Gene ENSMUSG00000025200
Gene NameCWF19-like 1, cell cycle control (S. pombe)
Synonyms2610528C06Rik
MMRRC Submission 043206-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.846) question?
Stock #R5785 (G1)
Quality Score166
Status Not validated
Chromosome19
Chromosomal Location44108644-44135876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44121941 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 290 (F290S)
Ref Sequence ENSEMBL: ENSMUSP00000026218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026218]
Predicted Effect probably damaging
Transcript: ENSMUST00000026218
AA Change: F290S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026218
Gene: ENSMUSG00000025200
AA Change: F290S

DomainStartEndE-ValueType
Pfam:CwfJ_C_1 314 433 5.6e-37 PFAM
Pfam:CwfJ_C_2 439 534 2.1e-19 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CWF19 protein family. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia-17 and mild mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A T 9: 99,620,672 N295I probably damaging Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Apbb1 C A 7: 105,567,715 D254Y probably damaging Het
Arhgap39 T C 15: 76,737,418 M328V probably benign Het
Bub1b T A 2: 118,609,844 V143D probably damaging Het
Celsr3 A G 9: 108,827,797 D493G probably damaging Het
Cers4 T A 8: 4,516,992 probably null Het
Clec4d A G 6: 123,274,770 R204G probably benign Het
Cngb1 C A 8: 95,254,195 R910L possibly damaging Het
Coro2a A T 4: 46,564,691 N18K probably benign Het
Esp18 C T 17: 39,409,948 T28I probably damaging Het
Hdac10 A T 15: 89,126,945 F205Y probably benign Het
Hhip T A 8: 79,998,192 H317L possibly damaging Het
Il1f8 G A 2: 24,154,649 M20I probably benign Het
Ilf3 T A 9: 21,394,872 N276K probably damaging Het
Jchain T C 5: 88,522,517 N81S probably benign Het
Mei4 A G 9: 82,025,547 Y211C probably damaging Het
Mx2 A T 16: 97,538,704 E20V possibly damaging Het
Ndufa10 A G 1: 92,460,374 probably null Het
Nodal A G 10: 61,423,677 T298A probably damaging Het
Nvl T C 1: 181,139,298 Y47C probably damaging Het
Olfr1500 T C 19: 13,827,619 Y259C probably damaging Het
Onecut1 C T 9: 74,863,392 R366C probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp5c A G 7: 17,027,691 probably null Het
Prag1 A G 8: 36,103,487 E408G probably benign Het
Ptpn21 T C 12: 98,682,550 N949S probably damaging Het
Scn7a A C 2: 66,697,568 N859K possibly damaging Het
Smarca4 T C 9: 21,686,026 I1362T probably damaging Het
Syt12 T C 19: 4,450,994 R343G possibly damaging Het
Topbp1 T C 9: 103,323,528 S587P probably benign Het
Trim80 C T 11: 115,446,475 Q388* probably null Het
Tsc2 T C 17: 24,599,887 probably null Het
Vmn2r3 T A 3: 64,259,023 T896S possibly damaging Het
Vmn2r-ps130 T A 17: 23,061,487 S41T probably benign Het
Xirp2 A G 2: 67,509,662 E749G probably damaging Het
Zbtb24 G A 10: 41,451,853 G245E probably benign Het
Zfp507 A G 7: 35,787,742 V767A probably benign Het
Other mutations in Cwf19l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Cwf19l1 APN 19 44131410 critical splice donor site probably null
IGL01691:Cwf19l1 APN 19 44120872 critical splice donor site probably null
IGL02427:Cwf19l1 APN 19 44133023 nonsense probably null
IGL03234:Cwf19l1 APN 19 44127370 missense probably damaging 1.00
IGL03236:Cwf19l1 APN 19 44127448 missense probably benign 0.00
IGL03275:Cwf19l1 APN 19 44123257 missense probably benign 0.10
R0068:Cwf19l1 UTSW 19 44131499 missense probably damaging 0.99
R0068:Cwf19l1 UTSW 19 44131499 missense probably damaging 0.99
R0486:Cwf19l1 UTSW 19 44114690 missense probably benign 0.35
R1820:Cwf19l1 UTSW 19 44127387 missense probably benign 0.00
R2317:Cwf19l1 UTSW 19 44132158 missense possibly damaging 0.92
R2418:Cwf19l1 UTSW 19 44131472 missense probably benign
R2438:Cwf19l1 UTSW 19 44110563 missense probably benign 0.00
R3796:Cwf19l1 UTSW 19 44114567 missense probably damaging 0.97
R3850:Cwf19l1 UTSW 19 44131498 missense probably benign 0.24
R4518:Cwf19l1 UTSW 19 44133034 missense probably damaging 1.00
R4855:Cwf19l1 UTSW 19 44114567 missense probably damaging 0.97
R5402:Cwf19l1 UTSW 19 44133085 critical splice acceptor site probably null
R5587:Cwf19l1 UTSW 19 44120877 missense possibly damaging 0.49
R6354:Cwf19l1 UTSW 19 44127473 missense probably benign 0.10
R6652:Cwf19l1 UTSW 19 44114699 missense probably benign 0.11
R7365:Cwf19l1 UTSW 19 44132140 missense probably damaging 1.00
R7548:Cwf19l1 UTSW 19 44110550 missense probably benign 0.18
R7562:Cwf19l1 UTSW 19 44129241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCAGAAGATGCTCTTAGC -3'
(R):5'- TGGCCTAGTGGAAAATTGCTC -3'

Sequencing Primer
(F):5'- GCTCTTAGCAATGCAACTTTCCAAAC -3'
(R):5'- GCCTAGTGGAAAATTGCTCTGTATC -3'
Posted On2016-12-15