Mutagenetix > Incidental Mutations

Incidental Mutation 'R5786:Tgm3'

447997

Institutional Source

Beutler Lab

Gene Symbol

Tgm3

Ensembl Gene

ENSMUSG00000027401

Gene Name

transglutaminase 3, E polypeptide

Synonyms

TG E

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5786 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

130012349-130050399 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 130026784 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 214 (K214*)

Ref Sequence

ENSEMBL: ENSMUSP00000105928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110299]

Predicted Effect

probably null
Transcript: ENSMUST00000110299
AA Change: K214*

SMART Domains

Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401
AA Change: K214*

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	5	118	8.3e-33	PFAM
TGc	265	357	6.4e-39	SMART
Pfam:Transglut_C	483	588	3.9e-26	PFAM
Pfam:Transglut_C	595	693	4.9e-24	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810009J06Rik	T	A	6: 40,968,188	D200E	probably damaging	Het
4930578I06Rik	C	A	14: 63,973,242	R179L	probably damaging	Het
Abhd5	A	G	9: 122,363,803		probably null	Het
Ankrd60	TGGCCACGCGG	TGG	2: 173,578,089		probably null	Het
Ano5	G	A	7: 51,566,318	D348N	possibly damaging	Het
Apob	C	T	12: 8,015,304	T4091I	possibly damaging	Het
Avil	G	A	10: 127,016,499		probably null	Het
C530008M17Rik	T	C	5: 76,866,196		probably null	Het
Cacna1a	T	C	8: 84,415,721		probably benign	Het
Capn7	T	C	14: 31,360,145	L436P	probably damaging	Het
Ccdc33	A	G	9: 58,029,952	S655P	possibly damaging	Het
Ccr6	T	C	17: 8,256,412	S150P	probably damaging	Het
Cd1d1	T	C	3: 86,998,788	N60S	probably benign	Het
Ckap5	A	G	2: 91,616,296		probably null	Het
Col15a1	A	G	4: 47,280,865	E753G	possibly damaging	Het
Col1a2	C	T	6: 4,530,223	R699W	unknown	Het
Csf2rb	T	C	15: 78,348,955	Y821H	probably damaging	Het
Cyp3a11	A	G	5: 145,862,474	I301T	possibly damaging	Het
Dpp3	C	T	19: 4,918,322	G241R	possibly damaging	Het
Dpyd	G	T	3: 119,427,237	M952I	probably damaging	Het
Dsg3	A	T	18: 20,521,571	I111L	possibly damaging	Het
Ect2	A	G	3: 27,146,953	F123L	probably damaging	Het
Ehmt2	G	C	17: 34,910,743	D961H	probably damaging	Het
Esp1	A	G	17: 40,730,918	I34V	probably benign	Het
Fam171b	G	A	2: 83,878,236	V361I	probably benign	Het
Flnc	T	A	6: 29,459,537	Y2545*	probably null	Het
Fmo4	C	T	1: 162,803,717	G227D	probably benign	Het
Grn	C	T	11: 102,434,043	Q153*	probably null	Het
H2-DMb1	T	G	17: 34,153,434	S12R	possibly damaging	Het
Ica1	G	T	6: 8,672,391	N203K	possibly damaging	Het
Kdm4c	C	A	4: 74,359,485	T792K	probably damaging	Het
Kif19a	T	A	11: 114,779,223	Y81*	probably null	Het
Kifc2	G	T	15: 76,664,378	C440F	probably damaging	Het
Lpin2	A	G	17: 71,230,273	T234A	probably benign	Het
Lysmd2	C	A	9: 75,635,603	P164Q	probably benign	Het
Maea	T	A	5: 33,368,683	D234E	probably benign	Het
Map4k1	T	A	7: 29,000,020	V572E	probably damaging	Het
Med6	C	T	12: 81,573,959	G166R	probably null	Het
Mtmr10	T	C	7: 64,337,710	I666T	probably damaging	Het
Myh14	T	A	7: 44,613,463	K1777M	probably benign	Het
Naip6	G	T	13: 100,300,216	Q600K	probably benign	Het
Obscn	A	G	11: 59,032,691	S6461P	probably damaging	Het
Olfr350	T	C	2: 36,850,049	M1T	probably null	Het
Osbpl7	T	A	11: 97,065,832	V567E	probably damaging	Het
Rad51ap2	A	T	12: 11,456,920	D281V	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rpl24	C	A	16: 55,967,153	H59N	possibly damaging	Het
Rtl1	G	A	12: 109,592,619	L929F	possibly damaging	Het
Runx3	C	T	4: 135,163,264	T159I	probably damaging	Het
Serpine2	T	C	1: 79,816,920	I99V	probably benign	Het
Slc12a6	C	A	2: 112,284,722	P12Q	probably benign	Het
Slc25a18	T	C	6: 120,792,074	L184P	probably damaging	Het
Smg1	T	C	7: 118,212,897	D57G	probably benign	Het
Spdye4c	T	A	2: 128,596,841	*340K	probably null	Het
Srsf5	G	A	12: 80,949,537	E162K	possibly damaging	Het
Ssc5d	T	C	7: 4,936,818	V751A	probably benign	Het
Tcf3	T	C	10: 80,419,499	N157S	probably benign	Het
Tdrd7	T	C	4: 45,989,082	V71A	probably benign	Het
Tex14	T	C	11: 87,514,295	C678R	probably damaging	Het
Vps53	A	G	11: 76,063,007	I659T	probably benign	Het
Zfp597	A	T	16: 3,866,159	C244*	probably null	Het
Zfp933	T	A	4: 147,828,407		probably null	Het

Other mutations in Tgm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Tgm3	APN	2	130038413	missense	probably damaging	1.00
IGL00924:Tgm3	APN	2	130038374	missense	probably damaging	1.00
IGL01469:Tgm3	APN	2	130024494	missense	probably damaging	1.00
IGL01722:Tgm3	APN	2	130044568	missense	probably damaging	0.99
IGL01787:Tgm3	APN	2	130047740	missense	possibly damaging	0.85
IGL02269:Tgm3	APN	2	130024518	missense	probably benign	0.02
IGL02437:Tgm3	APN	2	130030041	splice site	probably null
IGL02449:Tgm3	APN	2	130038609	critical splice donor site	probably null
IGL02992:Tgm3	APN	2	130041979	missense	probably damaging	1.00
tortellini	UTSW	2	130024585	critical splice donor site	probably benign
ANU74:Tgm3	UTSW	2	130048390	missense	probably damaging	1.00
R0523:Tgm3	UTSW	2	130044662	critical splice donor site	probably null
R0833:Tgm3	UTSW	2	130026682	splice site	probably benign
R0834:Tgm3	UTSW	2	130026757	missense	probably benign	0.00
R0836:Tgm3	UTSW	2	130026682	splice site	probably benign
R0940:Tgm3	UTSW	2	130012406	missense	probably benign	0.00
R1354:Tgm3	UTSW	2	130041898	missense	probably benign
R1642:Tgm3	UTSW	2	130047782	missense	probably damaging	1.00
R1670:Tgm3	UTSW	2	130041768	nonsense	probably null
R1715:Tgm3	UTSW	2	130026814	critical splice donor site	probably null
R1944:Tgm3	UTSW	2	130029969	missense	probably damaging	0.99
R2104:Tgm3	UTSW	2	130037483	missense	probably benign	0.39
R3416:Tgm3	UTSW	2	130047772	missense	possibly damaging	0.84
R3417:Tgm3	UTSW	2	130047772	missense	possibly damaging	0.84
R4231:Tgm3	UTSW	2	130044589	nonsense	probably null
R4296:Tgm3	UTSW	2	130038413	missense	possibly damaging	0.77
R4794:Tgm3	UTSW	2	130041955	missense	probably benign	0.00
R4948:Tgm3	UTSW	2	130048320	missense	probably benign	0.00
R5034:Tgm3	UTSW	2	130037484	missense	possibly damaging	0.95
R5144:Tgm3	UTSW	2	130048282	missense	possibly damaging	0.95
R6030:Tgm3	UTSW	2	130042000	missense	probably damaging	1.00
R6030:Tgm3	UTSW	2	130042000	missense	probably damaging	1.00
R6182:Tgm3	UTSW	2	130025301	nonsense	probably null
R6219:Tgm3	UTSW	2	130038610	critical splice donor site	probably null
R6901:Tgm3	UTSW	2	130041970	missense	possibly damaging	0.95
R6969:Tgm3	UTSW	2	130042029	missense	probably benign	0.06
R6980:Tgm3	UTSW	2	130026777	missense	probably benign	0.17
R7282:Tgm3	UTSW	2	130024561	missense	probably benign	0.00
R7317:Tgm3	UTSW	2	130048291	missense	probably benign	0.09
R7513:Tgm3	UTSW	2	130024404	missense	probably benign	0.00
R7517:Tgm3	UTSW	2	130041764	missense	probably benign	0.01
R7793:Tgm3	UTSW	2	130012410	critical splice donor site	probably null
R7822:Tgm3	UTSW	2	130041899	missense	probably benign	0.00
R7955:Tgm3	UTSW	2	130038480	missense	probably benign
R8747:Tgm3	UTSW	2	130044532	missense	probably benign	0.03
X0065:Tgm3	UTSW	2	130024510	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TCCTTGTTCCAGTAATTAGCCAAC -3'
(R):5'- ACACCTAAAGGGCATGTTCCC -3'

Sequencing Primer
(F):5'- GTAATTAGCCAACAAACTGGGTC -3'
(R):5'- TTGAAACCAGCCATGCTTGG -3'

Posted On

2016-12-15