Incidental Mutation 'R5786:Ect2'
ID447999
Institutional Source Beutler Lab
Gene Symbol Ect2
Ensembl Gene ENSMUSG00000027699
Gene Nameect2 oncogene
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5786 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location27097222-27153878 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27146953 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 123 (F123L)
Ref Sequence ENSEMBL: ENSMUSP00000135208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108298] [ENSMUST00000108300] [ENSMUST00000175857] [ENSMUST00000176242] [ENSMUST00000176535] [ENSMUST00000176780] [ENSMUST00000177055] [ENSMUST00000184113]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108296
Predicted Effect probably damaging
Transcript: ENSMUST00000108298
AA Change: F93L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103933
Gene: ENSMUSG00000027699
AA Change: F93L

DomainStartEndE-ValueType
BRCT 143 219 1.45e-10 SMART
BRCT 237 313 2.52e-10 SMART
low complexity region 331 341 N/A INTRINSIC
RhoGEF 425 609 3.22e-67 SMART
Blast:PH 636 763 9e-81 BLAST
low complexity region 825 839 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108300
AA Change: F124L

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103935
Gene: ENSMUSG00000027699
AA Change: F124L

DomainStartEndE-ValueType
BRCT 174 250 1.45e-10 SMART
BRCT 268 344 2.52e-10 SMART
low complexity region 362 372 N/A INTRINSIC
RhoGEF 456 640 3.22e-67 SMART
Blast:PH 667 794 1e-80 BLAST
low complexity region 856 870 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175857
AA Change: F123L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135208
Gene: ENSMUSG00000027699
AA Change: F123L

DomainStartEndE-ValueType
Blast:BRCT 139 161 2e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000176242
AA Change: F93L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135740
Gene: ENSMUSG00000027699
AA Change: F93L

DomainStartEndE-ValueType
BRCT 143 219 1.45e-10 SMART
BRCT 237 313 2.52e-10 SMART
low complexity region 331 341 N/A INTRINSIC
RhoGEF 425 609 3.22e-67 SMART
Blast:PH 636 763 9e-81 BLAST
low complexity region 825 839 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176535
AA Change: F124L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135630
Gene: ENSMUSG00000027699
AA Change: F124L

DomainStartEndE-ValueType
Blast:BRCT 140 162 4e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000176780
AA Change: F93L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134786
Gene: ENSMUSG00000027699
AA Change: F93L

DomainStartEndE-ValueType
SCOP:d1gzhb1 117 174 5e-5 SMART
Blast:BRCT 143 174 4e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000177055
AA Change: F123L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134744
Gene: ENSMUSG00000027699
AA Change: F123L

DomainStartEndE-ValueType
Blast:BRCT 139 161 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196926
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor and transforming protein that is related to Rho-specific exchange factors and yeast cell cycle regulators. The expression of this gene is elevated with the onset of DNA synthesis and remains elevated during G2 and M phases. In situ hybridization analysis showed that expression is at a high level in cells undergoing mitosis in regenerating liver. Thus, this protein is expressed in a cell cycle-dependent manner during liver regeneration, and is thought to have an important role in the regulation of cytokinesis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Homozygous disruption of this locus is embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,188 D200E probably damaging Het
4930578I06Rik C A 14: 63,973,242 R179L probably damaging Het
Abhd5 A G 9: 122,363,803 probably null Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Apob C T 12: 8,015,304 T4091I possibly damaging Het
Avil G A 10: 127,016,499 probably null Het
C530008M17Rik T C 5: 76,866,196 probably null Het
Cacna1a T C 8: 84,415,721 probably benign Het
Capn7 T C 14: 31,360,145 L436P probably damaging Het
Ccdc33 A G 9: 58,029,952 S655P possibly damaging Het
Ccr6 T C 17: 8,256,412 S150P probably damaging Het
Cd1d1 T C 3: 86,998,788 N60S probably benign Het
Ckap5 A G 2: 91,616,296 probably null Het
Col15a1 A G 4: 47,280,865 E753G possibly damaging Het
Col1a2 C T 6: 4,530,223 R699W unknown Het
Csf2rb T C 15: 78,348,955 Y821H probably damaging Het
Cyp3a11 A G 5: 145,862,474 I301T possibly damaging Het
Dpp3 C T 19: 4,918,322 G241R possibly damaging Het
Dpyd G T 3: 119,427,237 M952I probably damaging Het
Dsg3 A T 18: 20,521,571 I111L possibly damaging Het
Ehmt2 G C 17: 34,910,743 D961H probably damaging Het
Esp1 A G 17: 40,730,918 I34V probably benign Het
Fam171b G A 2: 83,878,236 V361I probably benign Het
Flnc T A 6: 29,459,537 Y2545* probably null Het
Fmo4 C T 1: 162,803,717 G227D probably benign Het
Grn C T 11: 102,434,043 Q153* probably null Het
H2-DMb1 T G 17: 34,153,434 S12R possibly damaging Het
Ica1 G T 6: 8,672,391 N203K possibly damaging Het
Kdm4c C A 4: 74,359,485 T792K probably damaging Het
Kif19a T A 11: 114,779,223 Y81* probably null Het
Kifc2 G T 15: 76,664,378 C440F probably damaging Het
Lpin2 A G 17: 71,230,273 T234A probably benign Het
Lysmd2 C A 9: 75,635,603 P164Q probably benign Het
Maea T A 5: 33,368,683 D234E probably benign Het
Map4k1 T A 7: 29,000,020 V572E probably damaging Het
Med6 C T 12: 81,573,959 G166R probably null Het
Mtmr10 T C 7: 64,337,710 I666T probably damaging Het
Myh14 T A 7: 44,613,463 K1777M probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Obscn A G 11: 59,032,691 S6461P probably damaging Het
Olfr350 T C 2: 36,850,049 M1T probably null Het
Osbpl7 T A 11: 97,065,832 V567E probably damaging Het
Rad51ap2 A T 12: 11,456,920 D281V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpl24 C A 16: 55,967,153 H59N possibly damaging Het
Rtl1 G A 12: 109,592,619 L929F possibly damaging Het
Runx3 C T 4: 135,163,264 T159I probably damaging Het
Serpine2 T C 1: 79,816,920 I99V probably benign Het
Slc12a6 C A 2: 112,284,722 P12Q probably benign Het
Slc25a18 T C 6: 120,792,074 L184P probably damaging Het
Smg1 T C 7: 118,212,897 D57G probably benign Het
Spdye4c T A 2: 128,596,841 *340K probably null Het
Srsf5 G A 12: 80,949,537 E162K possibly damaging Het
Ssc5d T C 7: 4,936,818 V751A probably benign Het
Tcf3 T C 10: 80,419,499 N157S probably benign Het
Tdrd7 T C 4: 45,989,082 V71A probably benign Het
Tex14 T C 11: 87,514,295 C678R probably damaging Het
Tgm3 A T 2: 130,026,784 K214* probably null Het
Vps53 A G 11: 76,063,007 I659T probably benign Het
Zfp597 A T 16: 3,866,159 C244* probably null Het
Zfp933 T A 4: 147,828,407 probably null Het
Other mutations in Ect2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Ect2 APN 3 27138669 missense probably benign 0.04
IGL00770:Ect2 APN 3 27098443 missense probably damaging 0.99
IGL00774:Ect2 APN 3 27098443 missense probably damaging 0.99
IGL01414:Ect2 APN 3 27127729 splice site probably benign
IGL02017:Ect2 APN 3 27122044 nonsense probably null
IGL02318:Ect2 APN 3 27138719 missense probably benign 0.16
IGL02395:Ect2 APN 3 27150106 missense probably damaging 1.00
IGL03109:Ect2 APN 3 27144972 missense possibly damaging 0.88
IGL03178:Ect2 APN 3 27148860 missense probably benign 0.03
IGL03055:Ect2 UTSW 3 27137062 missense probably damaging 1.00
PIT4504001:Ect2 UTSW 3 27126948 nonsense probably null
R0090:Ect2 UTSW 3 27115476 missense probably benign 0.00
R0090:Ect2 UTSW 3 27138502 missense probably null 0.08
R0436:Ect2 UTSW 3 27150095 missense probably benign 0.11
R0620:Ect2 UTSW 3 27139652 missense probably damaging 0.99
R1847:Ect2 UTSW 3 27150072 missense probably benign 0.01
R2404:Ect2 UTSW 3 27131850 missense probably benign 0.00
R3890:Ect2 UTSW 3 27138540 missense probably damaging 1.00
R3951:Ect2 UTSW 3 27130120 missense probably benign 0.00
R4588:Ect2 UTSW 3 27147000 missense probably damaging 1.00
R4754:Ect2 UTSW 3 27126963 missense probably damaging 1.00
R5051:Ect2 UTSW 3 27102486 missense probably benign
R5254:Ect2 UTSW 3 27130070 missense probably damaging 1.00
R5415:Ect2 UTSW 3 27146853 missense probably damaging 1.00
R5940:Ect2 UTSW 3 27115465 missense probably benign 0.01
R5974:Ect2 UTSW 3 27144963 nonsense probably null
R6012:Ect2 UTSW 3 27098325 utr 3 prime probably benign
R6434:Ect2 UTSW 3 27139119 nonsense probably null
R6447:Ect2 UTSW 3 27115484 missense probably damaging 1.00
R6850:Ect2 UTSW 3 27138885 missense probably damaging 1.00
R6989:Ect2 UTSW 3 27102488 nonsense probably null
R7147:Ect2 UTSW 3 27150090 missense probably benign 0.12
R7257:Ect2 UTSW 3 27138535 missense probably damaging 1.00
R7417:Ect2 UTSW 3 27098419 missense probably damaging 1.00
R7564:Ect2 UTSW 3 27116123 intron probably benign
R7662:Ect2 UTSW 3 27131798 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTAAGTGCTACGTGTACTCG -3'
(R):5'- AGAGCAAGGTCTTAATGTGTATGG -3'

Sequencing Primer
(F):5'- GCTACGTGTACTCGACAATTAACAG -3'
(R):5'- CTTAATGTGTATGGGGTTATATGACG -3'
Posted On2016-12-15