Incidental Mutation 'R5786:C530008M17Rik'
ID448011
Institutional Source Beutler Lab
Gene Symbol C530008M17Rik
Ensembl Gene ENSMUSG00000036377
Gene NameRIKEN cDNA C530008M17 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5786 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location76656512-76873554 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 76866196 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120639] [ENSMUST00000121160] [ENSMUST00000151567] [ENSMUST00000163347]
Predicted Effect probably null
Transcript: ENSMUST00000120639
SMART Domains Protein: ENSMUSP00000113796
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121160
SMART Domains Protein: ENSMUSP00000113947
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 45 172 1.8e-41 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 1034 1047 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149216
Predicted Effect probably null
Transcript: ENSMUST00000151567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152373
Predicted Effect probably null
Transcript: ENSMUST00000163347
SMART Domains Protein: ENSMUSP00000127212
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,188 D200E probably damaging Het
4930578I06Rik C A 14: 63,973,242 R179L probably damaging Het
Abhd5 A G 9: 122,363,803 probably null Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Apob C T 12: 8,015,304 T4091I possibly damaging Het
Avil G A 10: 127,016,499 probably null Het
Cacna1a T C 8: 84,415,721 probably benign Het
Capn7 T C 14: 31,360,145 L436P probably damaging Het
Ccdc33 A G 9: 58,029,952 S655P possibly damaging Het
Ccr6 T C 17: 8,256,412 S150P probably damaging Het
Cd1d1 T C 3: 86,998,788 N60S probably benign Het
Ckap5 A G 2: 91,616,296 probably null Het
Col15a1 A G 4: 47,280,865 E753G possibly damaging Het
Col1a2 C T 6: 4,530,223 R699W unknown Het
Csf2rb T C 15: 78,348,955 Y821H probably damaging Het
Cyp3a11 A G 5: 145,862,474 I301T possibly damaging Het
Dpp3 C T 19: 4,918,322 G241R possibly damaging Het
Dpyd G T 3: 119,427,237 M952I probably damaging Het
Dsg3 A T 18: 20,521,571 I111L possibly damaging Het
Ect2 A G 3: 27,146,953 F123L probably damaging Het
Ehmt2 G C 17: 34,910,743 D961H probably damaging Het
Esp1 A G 17: 40,730,918 I34V probably benign Het
Fam171b G A 2: 83,878,236 V361I probably benign Het
Flnc T A 6: 29,459,537 Y2545* probably null Het
Fmo4 C T 1: 162,803,717 G227D probably benign Het
Grn C T 11: 102,434,043 Q153* probably null Het
H2-DMb1 T G 17: 34,153,434 S12R possibly damaging Het
Ica1 G T 6: 8,672,391 N203K possibly damaging Het
Kdm4c C A 4: 74,359,485 T792K probably damaging Het
Kif19a T A 11: 114,779,223 Y81* probably null Het
Kifc2 G T 15: 76,664,378 C440F probably damaging Het
Lpin2 A G 17: 71,230,273 T234A probably benign Het
Lysmd2 C A 9: 75,635,603 P164Q probably benign Het
Maea T A 5: 33,368,683 D234E probably benign Het
Map4k1 T A 7: 29,000,020 V572E probably damaging Het
Med6 C T 12: 81,573,959 G166R probably null Het
Mtmr10 T C 7: 64,337,710 I666T probably damaging Het
Myh14 T A 7: 44,613,463 K1777M probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Obscn A G 11: 59,032,691 S6461P probably damaging Het
Olfr350 T C 2: 36,850,049 M1T probably null Het
Osbpl7 T A 11: 97,065,832 V567E probably damaging Het
Rad51ap2 A T 12: 11,456,920 D281V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpl24 C A 16: 55,967,153 H59N possibly damaging Het
Rtl1 G A 12: 109,592,619 L929F possibly damaging Het
Runx3 C T 4: 135,163,264 T159I probably damaging Het
Serpine2 T C 1: 79,816,920 I99V probably benign Het
Slc12a6 C A 2: 112,284,722 P12Q probably benign Het
Slc25a18 T C 6: 120,792,074 L184P probably damaging Het
Smg1 T C 7: 118,212,897 D57G probably benign Het
Spdye4c T A 2: 128,596,841 *340K probably null Het
Srsf5 G A 12: 80,949,537 E162K possibly damaging Het
Ssc5d T C 7: 4,936,818 V751A probably benign Het
Tcf3 T C 10: 80,419,499 N157S probably benign Het
Tdrd7 T C 4: 45,989,082 V71A probably benign Het
Tex14 T C 11: 87,514,295 C678R probably damaging Het
Tgm3 A T 2: 130,026,784 K214* probably null Het
Vps53 A G 11: 76,063,007 I659T probably benign Het
Zfp597 A T 16: 3,866,159 C244* probably null Het
Zfp933 T A 4: 147,828,407 probably null Het
Other mutations in C530008M17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:C530008M17Rik APN 5 76866056 unclassified probably benign
IGL00660:C530008M17Rik APN 5 76854933 critical splice acceptor site probably null
IGL00924:C530008M17Rik APN 5 76858986 missense unknown
IGL01025:C530008M17Rik APN 5 76658074 intron probably benign
IGL01122:C530008M17Rik APN 5 76870675 makesense probably null
IGL01393:C530008M17Rik APN 5 76858971 missense unknown
IGL01526:C530008M17Rik APN 5 76857631 missense unknown
IGL01986:C530008M17Rik APN 5 76858610 missense unknown
IGL02009:C530008M17Rik APN 5 76848970 missense possibly damaging 0.61
IGL02724:C530008M17Rik APN 5 76858459 missense unknown
IGL02869:C530008M17Rik APN 5 76859043 missense unknown
IGL03030:C530008M17Rik APN 5 76857616 missense unknown
IGL03150:C530008M17Rik APN 5 76867250 missense probably damaging 0.99
LCD18:C530008M17Rik UTSW 5 76658742 intron probably benign
R0975:C530008M17Rik UTSW 5 76856318 splice site probably benign
R1329:C530008M17Rik UTSW 5 76657932 intron probably benign
R1439:C530008M17Rik UTSW 5 76840910 missense probably damaging 0.99
R1750:C530008M17Rik UTSW 5 76857675 missense unknown
R1773:C530008M17Rik UTSW 5 76867205 missense possibly damaging 0.54
R1885:C530008M17Rik UTSW 5 76856742 missense unknown
R1924:C530008M17Rik UTSW 5 76858623 missense unknown
R2483:C530008M17Rik UTSW 5 76856409 missense probably damaging 0.98
R3840:C530008M17Rik UTSW 5 76859011 missense unknown
R3841:C530008M17Rik UTSW 5 76859011 missense unknown
R3874:C530008M17Rik UTSW 5 76840892 missense probably damaging 1.00
R3883:C530008M17Rik UTSW 5 76856574 missense unknown
R4033:C530008M17Rik UTSW 5 76858465 missense unknown
R4401:C530008M17Rik UTSW 5 76848916 missense probably damaging 0.98
R4749:C530008M17Rik UTSW 5 76858834 missense unknown
R4884:C530008M17Rik UTSW 5 76848835 missense probably damaging 1.00
R4980:C530008M17Rik UTSW 5 76857574 missense unknown
R5010:C530008M17Rik UTSW 5 76657834 utr 5 prime probably benign
R5086:C530008M17Rik UTSW 5 76857124 missense unknown
R5468:C530008M17Rik UTSW 5 76840763 intron probably benign
R5813:C530008M17Rik UTSW 5 76858428 missense unknown
R5866:C530008M17Rik UTSW 5 76857537 missense unknown
R5928:C530008M17Rik UTSW 5 76841734 intron probably benign
R6273:C530008M17Rik UTSW 5 76857721 missense unknown
R6577:C530008M17Rik UTSW 5 76866100 unclassified probably benign
R6838:C530008M17Rik UTSW 5 76858209 missense unknown
R6849:C530008M17Rik UTSW 5 76857010 missense unknown
R6849:C530008M17Rik UTSW 5 76857157 missense unknown
R6914:C530008M17Rik UTSW 5 76857007 missense unknown
R7017:C530008M17Rik UTSW 5 76856948 small deletion probably benign
R7094:C530008M17Rik UTSW 5 76859032 missense unknown
R7367:C530008M17Rik UTSW 5 76856602 missense unknown
R7394:C530008M17Rik UTSW 5 76856954 small deletion probably benign
R7436:C530008M17Rik UTSW 5 76856954 small deletion probably benign
R7443:C530008M17Rik UTSW 5 76856638 missense unknown
R7500:C530008M17Rik UTSW 5 76658058 missense unknown
R7566:C530008M17Rik UTSW 5 76866275 intron probably null
R7633:C530008M17Rik UTSW 5 76857520 missense unknown
R7728:C530008M17Rik UTSW 5 76857469 missense unknown
Z1176:C530008M17Rik UTSW 5 76857246 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTTCCTCACAGCAAACGC -3'
(R):5'- AGATTCTGCCAAACCAGGTTCC -3'

Sequencing Primer
(F):5'- TTCACAGAGAAGCCCGTGC -3'
(R):5'- GGTTCCCCTGCAAGCATAATAAAAC -3'
Posted On2016-12-15